primer design for PCR
suter at VAX.MPIZ-KOELN.MPG.d400.de
suter at VAX.MPIZ-KOELN.MPG.d400.de
Mon Mar 28 06:14:13 EST 1994
+> Hello netters,
+> I've picked a couple of primers to PCR my target and now wouuld like to
+> add restriction sites to the 5' ends of them. What are the
+> pitfalls, if any, to be avoided in doing this. Any helpful hints or
+> anecdotes will be greatly appreciated! Thanks in advance
+I follow the guidelines in the appendix for the NEB catalog listing cutting
+efficiencies vs. overhang length. Whatever the longest they report, I add a
+couple of extra bases onto that. I haven't had problems with the length of my
+5' overhang. I was able to get a primer with a 77 base overhang to PCR up
+just fine (the homologous region was about 22nt and I annealed at 55oC).
+Unless there are some constraints on cost, don't be stingy with the length
+of the overhang.
even better is the following:
if the target sequence is:
GTCGTACGTCAGTTTTGCAGCCAGTCAGTA (target sequence)
I try to synthesize a primer:
GTCGTACGTCAGTTTTGgAtCCTCAGTCAGTA (suter primer)
by a simple two basepair exchange (small caps) a BamHI site is created !
advantages:
1. the BamHI site is certainly far enough from the 5' end to allow digestion
2. this primer will anneal more specifically than those primers with an
added 10 bp (synthetic site plus GC clamp): compare the Tm !
by looking carefully at the target sequence, it is almost always possible
to find a 'cryptic' enzyme site, thus allowing the generation of a so-called
*suter* primer (in fact, this is a rip-off from somebody else, but why shouldn't
i get famous ?)
you don't believe this will work ? I have been using it for all my RACEs
in the last three years (note: RACE only uses ONE specific primer, the other
one is T17)
cheers,
clemens suter-crazzolara
mpi-z
cologne
germany
More information about the Methods
mailing list