PCR primer design with RE sites

[nicola fidler]

Hi, thought some experienced netters might be able to help me with my PCR primerdesign problem. I am trying to introduce a unique restriction enzyme site using my PCR primer by either base mutations or with the introduction of a single
codon. I realise by using palindromic restriction enzymes there will always be some self homology. My problem is this: when I put my chosen primer designs through Primer Detective, I'm given two type of primer self homology
The first is where there is the end homology with long flanking regions (the primers will be about 30bp)
             GCCGTCGGATGCGCCGGAATTCGCG
                             CTTAAGGCCGCGTAGGCTGCCG
The second is where there are intermittent alignments along the length of the primer
             GGCGTCGGATGCGCCGGAATTCGCG
             GCCCACCGAACGGATTCCTCGCAGG
Can someone please explain which is the better design if you have to live with self homolgy. I'm getting terribly confused and frustrated
Thanks, in anticipation,
Melisa Wall
University of Queensland
St Lucia, Australia