PCR primer design (keep eye on 3' end)

HARDIES at THORIN.UTHSCSA.EDU HARDIES at THORIN.UTHSCSA.EDU
Thu Nov 3 11:40:56 EST 1994


Melisa Wall asked which of the following PCR primer self complementarity
problem was worse:

1       5'     GCCGTCGGATGCGCCGGAATTCGCG   3'
                               ******  *
                          3'   CTTAAGGCCGCGTAGGCTGCCG  5'

2
        5'     GGCGTCGGATGCGCCGGAATTCGCG   3'
                * ** *  ****   * *    *
        3'     GCCCACCGAACGGATTCCTCGCAGG   5'

Hi Melisa,

I've added 5' and 3' and complementarity the way I assume that your
program is reporting its results.  This is very important to get
right, because the critical thing is to see what is happening with the
3' ends.  Match #1 above is potentially disasterous, because the
bottom primer will prime on the upper primer and extend, potentially
removing it completely from your rxn.  This is called "primer dimer".
It may be possible to squeeze by if you make your annealing temp. very
stringent, but most people would try to avoid perfect complementarity
of more than about 3 bp  involving the 3' end.  Even if the match
computes to a Tm below your annealing temp., the polymerase may
stabilize it and prime anyway.

Match #2 is inconsequential.  It doesn't result in polymerization. It
would only be a problem if it were so strong that the hybrid would
hold together at your annealing temp., thus holding both primers back
from priming. A good primer design program should give you some
quantitative indication of the stability.  This one isn't close to
being a problem, and you could hardly design two primers without this
much matching between them.

If the primer is self complementary such that it hairpins into a stem
loop, then it gains some stabilization from the intramolecular nature
of the structure.  A good design program will tell you if a primer has
a stable  enough hairpin to remove itself from your priming rxn at the
annealing temp. This would require a pretty impressive
self-complementary stem, however, so you could usually screen these
cases out by eye.

I hope this helps.

Steve Hardies, Dept. of Biochemistry, Univ. of Texas HSC at San
Antonio
Hardies at thorin.uthscsa.edu




More information about the Methods mailing list