PCR primer design with RE sites
Dan Oerther
doerther at nwu.edu
Thu Nov 3 14:28:29 EST 1994
In article <399j5d$lgn at brolga.cc.uq.oz.au>, btbirch at brolga.cc.uq.oz.au
(nicola fidler) wrote:
> Hi, thought some experienced netters might be able to help me with my
PCR primerdesign problem. I am trying to introduce a unique restriction
enzyme site using my PCR primer by either base mutations or with the
introduction of a single
> codon. I realise by using palindromic restriction enzymes there will
always be some self homology. My problem is this: when I put my chosen
primer designs through Primer Detective, I'm given two type of primer self
homology
> The first is where there is the end homology with long flanking regions
(the primers will be about 30bp)
> GCCGTCGGATGCGCCGGAATTCGCG
> CTTAAGGCCGCGTAGGCTGCCG
> The second is where there are intermittent alignments along the length
of the primer
> GGCGTCGGATGCGCCGGAATTCGCG
> GCCCACCGAACGGATTCCTCGCAGG
> Can someone please explain which is the better design if you have to
live with self homolgy. I'm getting terribly confused and frustrated
> Thanks, in anticipation,
> Melisa Wall
> University of Queensland
> St Lucia, Australia
Melisa-
Tm for nucleic acid hybridization (and therefore for oligo
hybridization) is based upon the longest continuous stretch of aligned
nucleotides. For example, if you have a 13mer that has 5nt alignment, 3nt
misalignment, and then 5nt alignment, the effective Tm is calculated from
a 5nt stretch not a 10nt stretch! Of course, many people, including
myself, have experienced primer dimer, and spurious PCR product production
when it appeared that the chosen annealing temperature would be
sufficiently high enough to overcome any small regions of alignment. So,
to make a confusing problem simple, my recipe is:
Design a primer with high GC content that has the smallest continuous
stretches of homology with any other potentially spurious non-specific
sites ( including self and cross-annealing).
Calculate an approximate Tm based of 4dC for G/C and 2dC for A/T summed
for the entire oligo.
Try (Tm-10), (Tm-5), (Tm), (Tm+5), and (Tm-5) to determine the optimum
temperature.
Very important, if possible use a hot start (i.e preheat everything
except Polymerase to 100dC for 5 min, then add Polymerase at 94dC) or heat
denature all of the reactions minus Polymerase for 5 min 100dC then
immediately put on ice for 10 min. Then add Polymerase while the reactions
are on ice and place the reactions into a 94dC preheated Thermal Cycler
Block (the machine)
Hope this helps to answer your question.
Best,
Dan
--
Dan Oerther
Departments of Civil Engineering and Biochemsitry
Northwestern University
Evanston, Illinois
doerther at nwu.edu
More information about the Methods
mailing list