>>>>>Help on Hybridization Tm<<<<<

CJF 90/10 INSERM belin at cimacpcu.univ-lyon1.fr
Tue Nov 29 12:09:08 EST 1994


Hello everybody

here my request, I've got a 254bp cDNA which I can calculate the Tm using
GeneJockey Software (Tm = 79.7°C) but this software gives only the
predicted Tm for DNA:DNA hybrids...for my studies I need to know the
predicted Tm for RNA:DNA hybrids which should be higher...Do you know a
freeware or shareware which could calculate, or the formula ? If you've
got such a software could you try to check for the RNA:DNA Tm ?
Here the sequence :

cattcctcagaaagggggagagtgactctcatcttttccttgaagaatgaagttggaggactcataaaagcgctgaaaat
cttccaggagaaccacgtgaacctgttacatattgagtcccggaaatcgaagcgaagaaactcagaatttgagatttttg
tggactgcgacatcaaccgagaacagctgaatgacatctttcccctgctaaagtcccacaccacggtcctctctgtggac
tcgcccgatcagct
 
Thanx everybody for your help

Bye
Roger



More information about the Methods mailing list