Q. about lambda repressor bind. site

Paul N Hengen pnh at fcsparc6.ncifcrf.gov
Thu Apr 13 17:27:18 EST 1995


In article <3mgnuc$31s at synapse.bms.com> patel_p at bms.com (taylor) writes:

| I had a couple of questions about the bacteriophage lambda 
| repressor binding site:
|
| 1)  The DNA sequence for which the repressor has the highest affinity

It would be the tallest letters on the sequence logo:
.         5' attatcaccgccggtgataaa 3'

See the logo on page 277 of this paper, or download it from
http://www-lmmb.ncifcrf.gov/~toms/

@article{Papp.helixrepa,
author = "P. P. Papp
     and D. K. Chattoraj
     and T. D. Schneider",
title = "Information Analysis of Sequences that Bind
the Replication Initiator {RepA}",
journal = "J. Mol. Biol.",
comment = "See the Cover of volume 233, number 2!",
volume = "233",
pages = "219-230",
year = "1993"}

| 2)  Is the affinity increased by the presence of 2 repressor binding
| sites in tandem, and if so, the ideal distance in bp between the two
| tandem sites.

Yes, they are cooperative binders. See this paper:

@article{Ptashne1980,
author = "M. Ptashne
     and A. Jeffrey
     and A. D. Johnson
     and R. Maurer
     and B. J. Meyer
     and C. O. Pabo
     and T. M. Roberts
     and R. T. Sauer",
title = "How the $\lambda$ Repressor and Cro Work",
journal = "Cell",
volume = "19",
pages = "1-11",
year = "1980"}

*******************************************************************************
* Paul N. Hengen, Ph.D.                           /--------------------------/*
* National Cancer Institute                       |Internet: pnh at ncifcrf.gov |*
* Laboratory of Mathematical Biology              |   Phone: (301) 846-5581  |*
* Frederick Cancer Research and Development Center|     FAX: (301) 846-5598  |*
* Frederick, Maryland 21702-1201 USA              /--------------------------/*
* - - - - -  Methods FAQ list -> http://www-lmmb.ncifcrf.gov/~pnh - - - - - - *
* - - -  Anonymous FTP from ftp.ncifcrf.gov as file pub/methods/FAQlist - - - *
*******************************************************************************



More information about the Methods mailing list