Charon 4a flanking sequence

Guy Plunkett III guy at genetics.wisc.edu
Wed Aug 9 13:26:16 EST 1995


In article <mcgorry-0408951217560001 at quadra950.pathology.pitt.edu>,
mcgorry at med.pitt.edu (Michael Gorry) wrote:

> Can anyone help in finding the sequence for lambda charon 4a?
> We can't find it in genbank or any of the papers reviewed to date.

Michael,

I put the following information together a few months ago, based on the
construction of Charon 4A. The vector has not been sequenced, so I cannot
guarantee that the information is 100% correct...

Left Arm, Charon 4A
Sequence is from ECOLACZ (accession no. V00296), 3078>3001
EcoRI site is over-lined with +'s
UPPER CASE is Left arm of Charon 4A
lower case is lacZ stuffer DNA

                                                         ++++++
TTATTATTATTTTTGACACCAGACCAACTGGTAATGGTAGCGACCGGCGCTCAGCTGGaattccgccgatactgacgg
AATAATAATAAAAACTGTGGTCTGGTTGACCATTACCATCGCTGGCCGCGAGTCGACCTTAAggcggctatgactgcc




Right Arm, Charon 4A
Sequence is from ECOUVRB2 (accession no. X03722). 120>300
EcoRI site is over-lined with +'s
UPPER CASE is Right arm of Charon 4A
lower case is bio256 stuffer DNA


                                 ++++++
caggtagcgactcatgagtaaaccgttcaaactgAATTCCGCTTTTAAACCTTCTGGCGATCAGCCAGAGGCGATTCG
gtccatcgctgagtactcatttggcaagtttgacttaaGGCGAAAATTTGGAAGACCGCTAGTCGGTCTCCGCTAAGC

ACGTCTCGAAGAGGGGCTGGAAGATGGCCTGGCGCACCAGACGTTACTTGGCGTGACTGGCTCAGGGAAAACCTTCAC
TGCAGAGCTTCTCCCCGACCTTCTACCGGACCGCGTGGTCTGCAATGAACCGCACTGACCGAGTCCCTTTTGGAAGTG

CATTGCCAATGTCATTGCTGACCTT
GTAACGGTTACAGTAACGACTGGAA


Cheers,
GUY

-- 
Dr.Guy Plunkett III for the E. coli Genome Project
Laboratory of Genetics
University of Wisconsin        Phone: (608) 262-2534
445 Henry Mall                 Fax:   (608) 263-7459
Madison, WI  53706             Internet: guy at genetics.wisc.edu

                "Life is too short, and DNA too long."
                  -- Michael Crichton, Jurassic Park



More information about the Methods mailing list