Problems with AT-rich sequence

Bengt Oxelman bengt.oxelman at systbot.gu.se
Sat Feb 4 07:29:01 EST 1995


We have recently started a project that involves sequencing of a 
AT-rich (60-70 %) sequence in the chloroplast genome. After amplifying
a 900-bp fragment, we have tried cycle sequencing, using a protocol 
that has worked well on amplified fragments of the nuclear rDNA 
(c. 40% AT). Now, we get sequences that are almost unreadable, because
of lots of 'false stops'. We would appreciate very much if anyone could
give us a hint on how to solve this problem. Lower extension temp? 
Different d/ddNTP concentrations? Tetramethyl ammonium chloride? Could 
the sequence close to the 3' of the primer cause problems (i.e. like
AGATGAGCAACACCCCCCCTAGAAA)?

Any thoughts greatly appreciated!

Bengt





More information about the Methods mailing list