How do I make a TA cloning vector?

Mike Hubank SchatzD2_lab at quickmail.yale.edu
Thu Mar 2 18:35:42 EST 1995


In article <3j55p2$rsl at steele.ohsu.edu>, "Markus Grompe, MD"
<grompem at ohsu.edu> wrote:

> I am looking for a protocol how to make myself a nice batch of vector
> with a single T overhang for cloning PCR products.
> 
> Does anyone out there have a good protocol for home use?

Try this :

Take a regular cloning vector with Nco1 site in the polylinker.(eg pGem 5Z)
Cut with Nco1
Insert the following linker
5'-catggataacatggccaacaaaac    -3'
3'-    ctattgtaccggttgttttgtac -5'

clone it.
Cut it with Xcm1.  This cuts at CCA(5)cut(4)TGG, cutting twice in your
insert to leave overhanging T's due to the intervening sequence.
Gel purify away the 15 bp fragment excised.
If you then phosphatase treat the cut T-Vector (to minimise religations),
remember to Kinase your PCR-products (or use 5'phosphorylated oligos)!

Try it. It works a treat.

Mike Hubank
HHMI 
Yale



More information about the Methods mailing list