Invitrogen SP6 and T7 primers...

John Dixon jpcd0 at mole.bio.cam.ac.uk
Thu Mar 30 11:31:56 EST 1995


Hi John,

We use 5' lengthened M13 forward and reverse primers for stringent PCR

CGACGTTGTAAAACGACGGCCAGT Forward Tm 71 (OLIGO salt .5M)
(nasty hairpin here:
      5' CGACGTTGT
            ||||  )
3'  TGACGGCAGCAAAA    Tm 57 ! but seems to work OK down to 50 at least)


ACACAGGAAACAGCTATGACCATG Reverse Tm 63 (as above)
(the 3' CATG allows for 4bp 3' dimer but it seems to work OK too)

However the T7 primer AATACGACTCACTATAG has a heinous looking 3' dimer:

5' AATACGACTCACTATAG 3'
              ||||||
           5' GATATCACTCAGCATAA 3'

But it obviously does work for PCR somehow.
 
If you do make a high Tm SP6 or T7 primer that works well I would
appreciate the details

Good luck

Johnny D


In article <MjSUgNm00iWREC0Gk3 at andrew.cmu.edu>, "E. J. Meharra"
<em35+ at andrew.cmu.edu> wrote:

> Invitrogen sells SP6 and T7 primers that can be used for sequencing
> inserts in their pCDNAI vector. These are 19 and 20 mers, respectively.
> Has anyone designed and used larger primers (25mers+) with this vector
> for PCR?  Information regarding successful or unsuccessful attempts
> would be appreciated. BTW, I talked to Invitrogen but they could not be
> of any help.
> 
> Thanks,
> John

-- 
John Dixon                     Lab 44 (223) 334131
Wellcome/CRC Institute         Fax 44 (223) 334134
Dept Genetics
Cambridge University    
United Kingdom       e-m: jpcd0 at mole.bio.cam.ac.uk



More information about the Methods mailing list