PCR primers for lamda gt10?

[zhuang zuo]

neale at mbcf.stjude.org wrote:

>We are currently screening libraries in lambda gt10, and would like to check
>the size of the inserts (cDNA) by PCR. Inserts are cloned into the Eco RI site.

>Does anyone have sequences of primers (and PCR conditions if available) that
>work in lambda gt10?                                                          

>Thanks in advance,

>Geoff Neale

>================================================================================
>Dept. of Virology and Molecular Biology       
>St. Jude Children's Research Hospital           
>Memphis, TN                                    
>Phone: (901) 495-3400
>Fax:   (901) 523-2622                                              
>e-mail: geoffrey.neale at stjude.org
>================================================================================

Geoff,
  I've always just used the same primers sequences that NEB sells:
AGCAAGTTCAGCCTGGTTAAG
CTTATGAGTATTTCTTCCAGGGTA
Hope this works for you.
John
mcelverja at phibred.com