DNA extraction from polysaccharide-laden plant tissue
Michelle Gleeson
michelle at MOLECULE.BIO.UTS.EDU.AU
Mon Dec 9 23:47:04 EST 1996
Hi Robert,
I sent a message direct to the first poster, but there is something wrong
with your address, so I am posting via the group.
You could try:
Dellaporta et al, 1983 Plant Molecular Biology Reporter Vol 1 No 4 p 19-21
" A Plant DNA Minipreparation Version II". I have used it successfully on
various citrus species for total nucleic acid extractions, and the lab I
got the paper from had been using it to extract from grapevines, which are
one of the toughest plants to get quality DNA from. The method is
relatively fast and simple.
Good luck,
AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit Ph (02)95144043
University of Technology Fax (02)95144003
Sydney AUSTRALIA
michelle.gleeson at uts.edu.au
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
On 9 Dec 1996, Robert Hamilton wrote:
> We have also been having similar problems, and could use some help!
>
>
> Steve Pechous <swp108 at psu.edu> wrote:
> Hi everyone,
> I have been trying to isolate DNA from a climbing vine
> (Virginia creeper). This tissue (young leaf) contains very high levels
> of
> polysaccharides. After CTAB/chloroform extraction, I use
> 5M NaCL to remove sugars. I have has some success (one prep. worked fine
> as a template
> for PCR), but results are inconsistent at best. After 2 or 3 high salt
> ppt.'s, there
> usually is little or no DNA left. Does anyone have any suggestions for
> improving yield
> and purity?
>
>
>
>
More information about the Methods
mailing list