Licor and phage clones

Michelle Gleeson michelle at MOLECULE.BIO.UTS.EDU.AU
Tue Dec 10 20:46:37 EST 1996


G'day all,

Has anyone out there successfully sequenced lambda phage clones directly
using the Licor DNA 4000L or similar?  I would like to sequence the ends
of my clones using the SP6 and T7 promoters flanking the insert in the
vector I am using (Lambda GEM 11).  Any suggestions or protocols would be
greatly appreciated

Thanks in advance,


AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit     Ph  (02)95144043
University of Technology        Fax (02)95144003
Sydney AUSTRALIA
michelle.gleeson at uts.edu.au
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT




More information about the Methods mailing list