Problem Blotting of Pulsed Field Gels
Michelle Gleeson
michelle at MOLECULE.BIO.UTS.EDU.AU
Tue Dec 17 21:44:00 EST 1996
Hi Pat,
Have you stained your gels after transfer to check if the DNA has actually
moved onto the membrane? The other thing is that I have had better
results using Schleicher and Schuell charged polyvinyl membrane. I use
the same protocol as in the Hybond N+ booklet for depurination etc.
Be careful not to depurinate too long, or it apparently breaks the DNA
into fragments too short to bind to the membrane well. You might also try
leaving capillary blots down longer, 36-48hrs. Hope this helps,
AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit Ph (02)95144043
University of Technology Fax (02)95144003
Sydney AUSTRALIA
michelle.gleeson at uts.edu.au
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
On Tue, 17 Dec 1996, J. Pat Martinez wrote:
> Hi,
>
> We are currently having difficulty blotting Soybean high mol. weight
> DNA. In the past, about 1 year ago, everything worked fine, its only
> recently that we've had problems. Even the Lambda standards are faint on
> the probed filters. We've tested the following to no avail.
>
> Depurination in 0.25M HCL for 0,10, or 20 minutes
> Neutral vs. alkaline blotting
> Traditional capillary blotting (24 hrs.) vs. vacuum blotting
> 1% 'standard' agarose vs. 1% Fast Lane agarose
>
> We use Whatman 3M filter paper and Hybond N+ membranes. Any suggestions
> to improve our blotting of PFGE gels?
>
> Pat M.
>
>
More information about the Methods
mailing list