Differential Display: best kit/primers?
Display Systems Biotech
dissyst at primenet.com
Tue Dec 17 21:36:03 EST 1996
Dear DDRT-PCR user,
Regarding DDRT-PCR kits, take a look at what Display Systems Biotech
offers in the DDRT kits which is priced under 500 dollars. The total
market value for all the components is above 1500 dollars. Besided the
pricing issue, the protocols are really detailed and includes all the
latest within DDRT-PCR. They also offer a Fluorescence DDRT_PCR kit +
DDRT-PCR Service. Much info is posted at the web site
http://www.displaysystems.com
9 downstream primers, conc. 25 µM, volume 300 µL
2 x 500 µl Ultrapure dNTPs, conc. 500 µM
100 µl displayTaqTM DNA Polymerase (5 units/ µl, 500 µnits)
2 ml displayTaqTM 10x reaction buffer
12.5 µl M-MuLV Reverse Transcriptase (20 units/ µl)
500 µl 5X First-strand buffer 2 ml, 25 mM Magnesiumchloride
24 upstream primers for Differential Display, conc. 2 µM, vol 750 µl
displayGel solutions, 2 optimized gel solutions for DDRT-PCR, 30 ml,
and SSCP gel for pre-conformation, screening of differential amplified
cDNA fragments, 30 ml
200 µl, 2 µM extended primers: T7-T11-A; T7-T11-C; T7-T11-G
200 µl, 2 µM T7 sequencing primer (T7 = 5 TAATACGACTCACTATAGGG)
CYCLESEQUENASETM complete reagent module for direct cycle sequencing
of 50 DDRT PCR fragments, CycleSequenase buffer, cycle-mix A,
cycle-mix C, cycle-mix G, cycle-mix T and control DNA
-Anthony Hawkins
bucci001 at maroon.tc.umn.edu (Paul A Bucciaglia) wrote:
>Hello all,
>I'm getting ready to try DDRT-PCR and would like to get comments on good
>or bad experiences with various kits. It seems like the kits are a good
>deal based on the cost to synthesize the primers, although Operon had a
>set of primers-only that was considerably cheaper than complete kits.
>I also recieved some info on kits from Clontech, Genomyx, and
>GenHunter--any comments on these?
>The Clontech kit used one primer (poly-T) for Rev. Txn., which cut down
>the number of reactions, while the other kits needed 4 separate Rev. txn
>reactions.
>Again, any feedback on these or other kits would be appreciated.
>TIA,
>Paul B.
More information about the Methods
mailing list