long range PCR of genomic insert in Lambda

[John Dixon]

In article <4sj5k2$8mg at sun4.bham.ac.uk>, c.hoege at bham.ac.uk (Carsten
Hoege) wrote:

> Hi there!
> 
> I want to make PCR with a genomic inserts of about 20kb in a genomic
library, that has been prepared in Lambda EMBL3. Has anyone experience
with it?
> 
> Thanks for any help
> 
> Carsten 

Hi Carsten, I had to amplify out some inserts from lambda fix that had
been cloned in a way that destroyed the cloning site. The easiest way
seemed to be to PCR them out, so I looked up the refs on how it was
constructed and made primers to the regions of +type lambda that flanked
the two BamHI sites involved. These worked a treat using Boerhinger Expand
(no affils-etc etc) at least up to 15kb pieces, and I think that EMBL3
uses the same regions. The sequence I use is :-

left arm pre-polylinker primer:-  atcgcttatctgcttctcatagagtcttgc
right arm pre-polylinker primer:- aacgatcatatacatggttctctccagagg 

They both leave about 40bps of lambda sequence before the poly-linker.

Let me know if you want any more info - I suppose if you just want to try
these, I could even lyophilize a bit and send it up to you (postal strikes
permitting, of course).

Good Luck

John

-- 
John Dixon                                        Lab 44 (1223) 334131
Wellcome/CRC Institute                            Fax 44 (1223) 334134
Department of Genetics
Cambridge University    
United Kingdom                           e-m: jpcd0 at mole.bio.cam.ac.uk