Gene targeting vectors

Chris Paszty pasz at MH1.LBL.GOV
Wed Jun 19 03:38:07 EST 1996



Netters:

There was a posting requesting information on gene knock-out strategies
and targeting vectors...here are 2 e-mail documents that I had put together
which deal with these topics...I've passed this information along by 
e-mailing it to labs that I knew were doing knock-outs but I'm sure I've
missed alot of them.  If you know of someone doing knock-outs please pass
this document on to them as they may find it useful.\


							October 1995
Gene targeters:

A couple of years ago I compiled the sequences of the PGKneo and PGKtk
cassettes that make up pPNT [ref: Tybulewicz et al. Cell vol 65 p1153-
1163 (1991)].  This compilation contained quite a bit of unpublished
sequence data and vector construction info that I got from a number
of labs (the PGK promoter and terminator sequences that are
in GenBank contain errors).  At any rate, there were a number of
requests for copies of it so I ended up e-mailing it out to a bunch of
knock-out labs.
For practical purposes this document is now kind of generic in form
in that it contains the sequence of pPNT, the sequences of 2 additional
pPNT based vectors: pPN2T [ref: Paszty et al. Nature Genetics vol 11
p33-39 (1995)] and pPN2T-hGHterm (unpublished), as well as some
general things to keep in mind when deciding on a targeting
strategy and when building targeting vectors.
Please pass this document on to any interested colleagues.  My only
request is that people pass out the whole thing so that those
individuals/labs that contributed to it are acknowledged.


Chris Paszty, Ph.D.
Human Genome Center
Lawrence Berkeley Laboratory
1 Cyclotron Rd., (MS 74-157)
Berkeley, CA 94720...U.S.A.
tel:  (510) 486-7498
fax:  (510) 486-6746
e-mail:  c_paszty at csa2.lbl.gov



Contributors of unpublished data/info:

Garry Hannan,  CSIRO, Australia:  PGK-1 promoter and terminator 
sequences

Victor Tybulewicz,  MRC, England:  details of construction of pPNT

Karen Jardine and Michael McBurney,  U. of Ottawa, Canada:  details 
of construction of pKJ1



Some general info:

pPNT is a pUC/Bluescript based vector...see Cell paper.

The most effective way to use pPNT and pPNT-derivatives is to clone
the short arm (1-2 kb) in-between the PGKneo cassette and the
PGKtk cassette, and then to clone the long arm (6-11 kb) in-between
the other side of the PGKneo cassette (PGK promoter side) and the
unique Not I site.  For electroporation the resulting targeting vector
can then be linearized at the unique Not I site.

In an effort to increase the effectiveness of positive-negative selection
I've introduced a second same orientation PGKtk cassette into the
single HindIII site of pPNT to create pPN2T.  The apparent negative
selection enrichment obtained with an alpha globin targeting vector
(pPN2T-alphaKO ) based on pPN2T was 3-5 fold higher than that
obtained with a variety of different single PGKtk based targeting
vectors that had been electroporated and selected under identical conditions
as those used for pPN2T-alphaKO  ie. same lab, same E.S. cells,
same feeder cells, same reagents and same protocols.  Although this has
not been rigorously tested it is likely that the additional 
PGKtk cassette present in pPN2T-alphaKO is responsible for the high
apparent enrichment values obtained with this targeting vector.

Creating a null allele knock-out for small genes is usually not too difficult
as one can just delete the whole gene or most of it to guarantee achieving
complete loss of gene function.  However, for larger genes, particularly
those who's genomic structure has not been well mapped out, creating
this type of whole gene deletion can be time consuming and difficult.
The targeting strategy we've been using for such large genes is to create
as extensive a deletion as is practical in the 5' region of the gene.  The
deletion is designed so as to include the presumed translational initiator
codon and at least 1 kb of sequence upstream from the ATG in an effort
to delete the promoter and thereby shut down transcription. Permanently
shutting down transcription is an extremely effective way to achieve
complete loss of gene function.  In situations where transcription isn't
shut down and a full length but mutated mRNA is produced one runs the
risk that the mutagenic (translational stop codons in 3 frames etc...) neo
cassette might be removed by normal or alternative splicing pathways.
This may result in a "leaky" mutation rather than a null mutation or, even
worse, a dominant negative mutation.  Because some genes have multiple
promoters which may be quite a distance upstream of the ATG, deleting
a 1 kb region upstream of the ATG, even if it does inactivate one of the
promoters, might not cause a complete shut down of transcription.
An additional "tool" for shutting down transcription is transcriptional 
termination.  For this reason it is desirable to end up with a targeting
event that results in the insertion of a polyA-signal/terminator in the
same orientation as the transcription of the gene in question.  For pPNT
and pPN2T if one's long arm is 5' of one's short arm within the
gene to be inactivated then the structure of the final targeting event
puts the PGKneo cassette in the same transcriptional orientation as
that of the gene's.  In this case, transcripts originating from the gene's
promoter(s) will terminate at the PGK polyA-signal/terminator that is
part of the PGKneo cassette.  This leaves any downstream exons
untranscribed and thus increases the probability of creating a null allele.
However, for pPNT and pPN2T, if one's short arm is 5' of one's
long arm within the gene to be inactivated then the structure of the
final targeting event will put the PGKneo cassette in reverse
transcriptional orientation with respect to that of the gene's.  Thus the
extra protection against the production of a "leaky" allele that is afforded
by the premature termination of any transcripts originating from the
gene's promoter(s) is lost.  To retain the feature of transcriptional
termination for this configuration of long and short arms we've
introduced the polyA-signal/terminator from the human growth
hormone N gene into pPN2T to create pPN2T-hGHterm.  Although
this is a human and not a murine polyA-signal/terminator, it is highly
homologous to other mammalian growth hormone
polyA-signal/terminators and has been extensively used in adenovirus
based gene therapy vectors in mice, so it should work just fine for
terminating transcription.

The standard null allele type knock-out is usually the most straight forward
to generate, however other approaches that should be considered are:
1) The inclusion of a reporter gene, such as lacZ (for example:
Le Mouellic et al 1992 Cell vol 69, p246-251; Mountford et al 1994 PNAS
vol 91 p4303-4307) in one's targeting vector.  This allows one to examine
the spatial and temporal pattern of gene expression of the targeted gene and
also to follow cell fate.
2) A conditional knock-out using Cre-loxP (Gu et al 1994 Science vol 265
p103-106; Kuhn et al 1995 Science vol 269, p1427-1429) and/or FLP-frt
(Fiering et al 1995 Genes and Development vol 9, p2203-2213).
Cell fate can also be followed using these recombinase systems.

Other variations on the basic knock-out theme will undoubtedly be
developed in the future, so it's wise to check the latest literature.
The particular approach one decides on is based on what information
one is interested in, as well as how much of a hurry one is in.  The
standard null allele type is still the simplest and quickest to make.  For
many genes a fair amount of information can be gotten from a null
allele knock-out.  If one is still intrigued then a subsequent fancier
knock-out can be generated.




The sequences and reference points for pPNT, pPN2T and pPN2T-hGHterm
are as follows:


Reference points for the pPNT sequence (bprs):

7-23  T3 promoter in pBluescript SK(+)

54-61  single NotI site in pPNT

71-78  single Sse8387I site in pPNT

81-587  EcoRI(destroyed)-TaqI fragment of PGK-1 promoter

589-1418  PstI-HincII(destroyed) neo gene containing frag from
             pKJ1deltaB (derived from pKJ1 which was derived from pMC1neo).

600-602  neo start codon

1401-1403  neo stop codon

1419-1883  PvuII(destroyed)-HindIII(filled) frag of PGK-1 terminator

1914-1919  single EcoRI site in pPNT

1914-2421  EcoRI-TaqI fragment of PGK-1 promoter

2423-4253  PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene.

2519-2521  tk start codon

3647-3649  tk stop codon

4257-4714  PstI-HindIII fragment of PGK-1 terminator

4714-7348  pUC18/Bluescript SK+  vector backbone



pPNT sequence:

GCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGT
GGCGGCCGCTCGAGGGCCCCTGCAGGTCAATTCTACCGGGTAGGGGAGGCGC
TTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGCACTTGGC
GCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGCGC
CAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTA
GTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAA
TGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCA
ATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTC
GCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGG
GCGGGCTCAGGGGCGGGGCGGGCGCGAAGGTCCTCCCGAGGCCCGGCATTCT
CGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCC
GGGCCTTTCGACCTGCAGCCAATATGGGATCGGCCATTGAACAAGATGGATT
GCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGG
GCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGC
AGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA
CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTT
GCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATT
GGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAG
AAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG
CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTAC
TCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAG
GGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACG
GCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTG
GAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGG
ACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGG
CGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATT
CGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGGGGATCGA
TCCGTCCTGTAAGTCTGCAGAAATTGATGATCTATTAAACAATAAAGATGTCC
ACTAAAATGGAAGTTTTTCCTGTCATACTTTGTTAAGAAGGGTGAGAACAGA
GTACCTACATTTTGAATGGAAGGATTGGAGCTACGGGGGTGGGGGTGGGGTG
GGATTAGATAAATGCCTGCTCTTTACTGAAGGCTCTTTACTATTGCTTTATGA
TAATGTTTCATAGTTGGATATCATAATTTAAACAAGCAAAACCAAATTAAGG
GCCAGCTCATTCCTCCCACTCATGATCTATAGATCTATAGATCTCTCGTGGGA
TCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAGTACTGTGGTTTCCA
AATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCAC
ATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGCTG
ACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC
TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAG
CAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACA
TTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGC
GCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCG
CGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCA
GATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGG
CCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTG
GGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCGAAGG
TCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCGCGC
TGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA
GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTC
GGCCAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACG
CGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTAC
GGCGTTGCGCCCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAG
AAAATGCCCACGCTACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGA
AAACCACCACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGT
CTACGTACCCGAGCCGATGACTTACTGGCGGGTGTTGGGGGCTTCCGAGACA
ATCGCGAACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGG
CCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAACAATGGGCATGC
CTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATATCGGGGGGGAGGCTGG
GAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCA
TCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCATGACC
CCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGCAC
AAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC
AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTC
GCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGG
GTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCCGCCCCAG
GGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGT
TATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTAT
AACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCA
TGTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGC
TGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCAT
ACCGACGATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCT
AACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC
AATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACG
CGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCAT
TGGGACCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTC
GGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAAGCCCTGCCAT
AGCCACGGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTAT
GGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGG
ACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGT
ACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCC
CCAAAAACCACCGCGCGGATTTCTGGCGCCGCCGGACGAACTAAACCTGACT
ACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGCGCTTTTGTTTTGTATTG
GTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGACCTGCAGAAATTGA
TGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTTCCTGTCATA
CTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAGGATTG
GAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTACT
GAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATT
TAAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCT
ATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTG
TGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACG
AGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAA
GTTCTAATTCCATCAG
AAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGA
AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG
CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG
TTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTAC
GCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCT
GCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCT
GACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGC
TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCAC
CGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTT
AATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGG
AAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATA
TGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGA
AAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTT
TTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA
AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAA
CTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACG
TTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTAT
CCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCT
CAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGA
TGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATA
ACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTA
ACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTG
GGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGA
TGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTA
CTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAA
AGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG
CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCA
CTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGG
GAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTG
CCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATA
CTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAA
GATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGT
TCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGAT
CCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCT
ACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA
AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTG
TAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATA
CCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT
CGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAG
CGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAAC
GACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCA
CGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTC
GGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCT
TTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGT
GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC
TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCC
TGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAG
CTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGC
GAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTG
GCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGG
GCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCC
CAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAG
CGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAA






Reference points for the pPN2T sequence (bprs):

7-23  T3 promoter in pBluescript SK(+)

54-61  single NotI site in pPN2T

71-78  single Sse8387I site in pPN2T

81-587  EcoRI(destroyed)-TaqI fragment of PGK-1 promoter

589-1418  PstI-HincII(destroyed) neo gene containing frag from
             pKJ1deltaB (derived from pKJ1 which was derived from pMC1neo).

600-602  neo start codon

1401-1403  neo stop codon

1419-1883  PvuII(destroyed)-HindIII(filled) frag of PGK-1 terminator

1914-1919  single EcoRI site in pPN2T

1914-2421  EcoRI-TaqI fragment of PGK-1 promoter

2423-4253  PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene.

2519-2521  tk start codon

3647-3649  tk stop codon

4257-4714  PstI-HindIII(filled) fragment of PGK-1 terminator

4718-5225  EcoRI(filled)-TaqI fragment of PGK-1 promoter

5227-7057  PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene.

5323-5325  tk start codon

6451-6453  tk stop codon

7061-7518  PstI-HindIII(filled) fragment of PGK-1 terminator

7518-10152  pUC18/Bluescript SK+  vector backbone



pPN2T sequence:

GCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGT
GGCGGCCGCTCGAGGGCCCCTGCAGGTCAATTCTACCGGGTAGGGGAGGCGC
TTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGCACTTGGC
GCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGCGC
CAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTA
GTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAA
TGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCA
ATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTC
GCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGG
GCGGGCTCAGGGGCGGGGCGGGCGCGAAGGTCCTCCCGAGGCCCGGCATTCT
CGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCC
GGGCCTTTCGACCTGCAGCCAATATGGGATCGGCCATTGAACAAGATGGATT
GCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGG
GCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGC
AGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA
CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTT
GCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATT
GGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAG
AAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG
CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTAC
TCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAG
GGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACG
GCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTG
GAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGG
ACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGG
CGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATT
CGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGGGGATCGA
TCCGTCCTGTAAGTCTGCAGAAATTGATGATCTATTAAACAATAAAGATGTCC
ACTAAAATGGAAGTTTTTCCTGTCATACTTTGTTAAGAAGGGTGAGAACAGA
GTACCTACATTTTGAATGGAAGGATTGGAGCTACGGGGGTGGGGGTGGGGTG
GGATTAGATAAATGCCTGCTCTTTACTGAAGGCTCTTTACTATTGCTTTATGA
TAATGTTTCATAGTTGGATATCATAATTTAAACAAGCAAAACCAAATTAAGG
GCCAGCTCATTCCTCCCACTCATGATCTATAGATCTATAGATCTCTCGTGGGA
TCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAGTACTGTGGTTTCCA
AATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCAC
ATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGCTG
ACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC
TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAG
CAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACA
TTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGC
GCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCG
CGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCA
GATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGG
CCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTG
GGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCGAAGG
TCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCGCGC
TGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA
GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTC
GGCCAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACG
CGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTAC
GGCGTTGCGCCCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAG
AAAATGCCCACGCTACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGA
AAACCACCACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGT
CTACGTACCCGAGCCGATGACTTACTGGCGGGTGTTGGGGGCTTCCGAGACA
ATCGCGAACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGG
CCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAACAATGGGCATGC
CTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATATCGGGGGGGAGGCTGG
GAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCA
TCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCATGACC
CCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGCAC
AAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC
AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTC
GCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGG
GTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCCGCCCCAG
GGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGT
TATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTAT
AACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCA
TGTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGC
TGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCAT
ACCGACGATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCT
AACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC
AATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACG
CGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCAT
TGGGACCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTC
GGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAAGCCCTGCCAT
AGCCACGGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTAT
GGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGG
ACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGT
ACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCC
CCAAAAACCACCGCGCGGATTTCTGGCGCCGCCGGACGAACTAAACCTGACT
ACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGCGCTTTTGTTTTGTATTG
GTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGACCTGCAGAAATTGA
TGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTTCCTGTCATA
CTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAGGATTG
GAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTACT
GAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATT
TAAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCT
ATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTG
TGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACG
AGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAA
GTTCTAATTCCATCAGAAGCTAATTC
TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAG
CAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACA
TTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGC
GCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCG
CGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCA
GATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGG
CCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTG
GGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCGAAGG
TCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCGCGC
TGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA
GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTC
GGCCAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACG
CGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTAC
GGCGTTGCGCCCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAG
AAAATGCCCACGCTACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGA
AAACCACCACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGT
CTACGTACCCGAGCCGATGACTTACTGGCGGGTGTTGGGGGCTTCCGAGACA
ATCGCGAACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGG
CCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAACAATGGGCATGC
CTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATATCGGGGGGGAGGCTGG
GAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCA
TCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCATGACC
CCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGCAC
AAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC
AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTC
GCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGG
GTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCCGCCCCAG
GGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGT
TATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTAT
AACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCA
TGTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGC
TGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCAT
ACCGACGATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCT
AACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC
AATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACG
CGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCAT
TGGGACCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTC
GGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAAGCCCTGCCAT
AGCCACGGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTAT
GGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGG
ACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGT
ACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCC
CCAAAAACCACCGCGCGGATTTCTGGCGCCGCCGGACGAACTAAACCTGACT
ACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGCGCTTTTGTTTTGTATTG
GTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGACCTGCAGAAATTGA
TGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTTCCTGTCATA
CTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAGGATTG
GAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTACT
GAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATT
TAAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCT
ATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTG
TGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACG
AGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAA
GTTCTAATTCCATCAGAAGCTAGCTT
GGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGA
AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG
CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG
TTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTAC
GCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCT
GCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCT
GACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGC
TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCAC
CGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTT
AATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGG
AAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATA
TGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGA
AAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTT
TTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA
AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAA
CTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACG
TTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTAT
CCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCT
CAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGA
TGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATA
ACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTA
ACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTG
GGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGA
TGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTA
CTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAA
AGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG
CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCA
CTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGG
GAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTG
CCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATA
CTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAA
GATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGT
TCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGAT
CCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCT
ACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA
AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTG
TAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATA
CCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT
CGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAG
CGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAAC
GACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCA
CGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTC
GGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCT
TTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGT
GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC
TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCC
TGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAG
CTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGC
GAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTG
GCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGG
GCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCC
CAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAG
CGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAA




Reference points for the pPN2T-hGHterm sequence (bprs):

7-23  T3 promoter in pBluescript SK(+)

54-61  single NotI site in pPN2T-hGHterm

71-78  single Sse8387I site in pPN2T-hGHterm

81-587  EcoRI(destroyed)-TaqI fragment of PGK-1 promoter

589-1418  PstI-HincII(destroyed) neo gene containing frag from
             pKJ1deltaB (derived from pKJ1 which was derived from pMC1neo).

600-602  neo start codon

1401-1403  neo stop codon

1419-1883  PvuII(destroyed)-HindIII(filled) frag of PGK-1 terminator

1887-1892  single XbaI site in pPN2T-hGHterm

1893-2477  reverse orientation hGH-N gene polyA signal/terminator

2478-2483 single BamHI site in pPN2T-hGHterm

2498-2503  single EcoRI site in pPN2T-hGHterm

2498-3005  EcoRI-TaqI fragment of PGK-1 promoter

3007-4837  PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene.

3103-3105  tk start codon

4231-4233  tk stop codon

4841-5298  PstI-HindIII(filled) fragment of PGK-1 terminator

5302-5809  EcoRI(filled)-TaqI fragment of PGK-1 promoter

5811-7641  PstI-PvuII(destroyed) frag from HSV-1 containing the tk gene.

5907-5909  tk start codon

7035-7037  tk stop codon

7645-8102  PstI-HindIII(filled) fragment of PGK-1 terminator

8102-10736  pUC18/Bluescript SK+  vector backbone



pPN2T-hGHterm sequence:

GCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGT
GGCGGCCGCTCGAGGGCCCCTGCAGGTCAATTCTACCGGGTAGGGGAGGCGC
TTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGCACTTGGC
GCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGCGC
CAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTA
GTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAA
TGGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCA
ATGGAAGCGGGTAGGCCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTC
GCTTTCTGGGCTCAGAGGCTGGGAAGGGGTGGGTCCGGGGGCGGGCTCAGGG
GCGGGCTCAGGGGCGGGGCGGGCGCGAAGGTCCTCCCGAGGCCCGGCATTCT
CGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTCCTCTTCCTCATCTCC
GGGCCTTTCGACCTGCAGCCAATATGGGATCGGCCATTGAACAAGATGGATT
GCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGG
GCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGC
AGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAA
CTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTT
GCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATT
GGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAG
AAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGG
CTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTAC
TCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAG
GGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACG
GCGATGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTG
GAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGG
ACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGG
CGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATT
CGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGGGGATCGA
TCCGTCCTGTAAGTCTGCAGAAATTGATGATCTATTAAACAATAAAGATGTCC
ACTAAAATGGAAGTTTTTCCTGTCATACTTTGTTAAGAAGGGTGAGAACAGA
GTACCTACATTTTGAATGGAAGGATTGGAGCTACGGGGGTGGGGGTGGGGTG
GGATTAGATAAATGCCTGCTCTTTACTGAAGGCTCTTTACTATTGCTTTATGA
TAATGTTTCATAGTTGGATATCATAATTTAAACAAGCAAAACCAAATTAAGG
GCCAGCTCATTCCTCCCACTCATGATCTATAGATCTATAGATCTCTCGTGGGA
TCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAGTACTGTGGTTTCCA
AATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCTCTGTTCCAC
ATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAAGCTG
ACTCTAGA
CAGGCATCTACTGAGTGGACCCAACGCATGAGAGGACAGTGCCAAGCAAGC
AACTCAAATGTCCCACCGGTTGGGCATGGCAGGTAGCCTATGCTGTGTCTGG
ACGTCCTCCTGCTGGTATAGTTATTTTAAAATCAGAAGGACAGGGAAGGGA
GCAGTGGTTCACGCCTGTAATCCCAGCAATTTGGGAGGCCAAGGTGGGTAGA
TCACCTGAGATTAGGAGTTGGAGACCAGCCTGGCCAATATGGTGAAACCCCG
TCTCTACCAAAAAAACAAAAATTAGCTGAGCCTGGTCATGCATGCCTGGAAT
CCCAACAACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCAGGAGGCG
GAGATTGCAGTGAGCCAAGATTGTGCCACTGCACTCCAGCTTGGTTCCCGAA
TAGACCCCGCAGGCCCTACAGGTTGTCTTCCCAACTTGCCCCTTGCTCCATAC
CACCCCCCTCCACCCCATAATATTATAGAAGGACACCTAGTCAGACAAAATG
ATGCAACTTAATTTTATTAGGACAAGGCTGGTGGGCACTGGAGTGGCAACTT
CCAAGGCCAGGAGA
GGATCCCCGGGTACCGAGCTCGAATTCTACCGGGTAGGGGAGGCGCTTTTCCCAA
GGCAGTCTGGAGCATGCGCTTTAGCAGCCCCGCTGGCACTTGGCGCTACACAAGT
GGCCTCTGGCCTCGCACACATTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTC
TTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCC
CGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACT
AGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGG
GGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAA
GGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGC
GAAGGTCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCG
CGCTGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA
GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTCGGC
CAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACGCGTCTGC
GTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTACGGCGTTGCGC
CCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAGAAAATGCCCACGC
TACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGAAAACCACCACCACGCA
ACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGTCTACGTACCCGAGCCGATG
ACTTACTGGCGGGTGTTGGGGGCTTCCGAGACAATCGCGAACATCTACACCACAC
AACACCGCCTCGACCAGGGTGAGATATCGGCCGGGGACGCGGCGGTGGTAATGA
CAAGCGCCCAGATAACAATGGGCATGCCTTATGCCGTGACCGACGCCGTTCTGGC
TCCTCATATCGGGGGGGAGGCTGGGAGCTCACATGCCCCGCCCCCGGCCCTCACC
CTCATCTTCGACCGCCATCCCATCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATA
CCTTATGGGCAGCATGACCCCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCG
CCGACCTTGCCCGGCACAAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACA
TCGACCGCCTGGCCAAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCT
GGCCGCGATTCGCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAG
GGCGGCGGGTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCC
GCCCCAGGGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGA
CACGTTATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGT
ATAACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCAT
GTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGCTGC
AACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCATACCGAC
GATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCTAACTGAAA
CACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGAC
AGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACGCGGGGTTCGGTCCC
AGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCATTGGGACCAATACGCCCG
CGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTCGGGTGAAGGCCCAGGGCTCG
CAGCCAACGTCGGGGCGGCAAGCCCTGCCATAGCCACGGGCCCCGTGGGTTAGG
GACGGGGTCCCCCATGGGGAATGGTTTATGGTTCGTGGGGGTTATTATTTTGGGC
GTTGCGTGGGGTCAGGTCCACGACTGGACTGAGCAGACAGACCCATGGTTTTTGG
ATGGCCTGGGCATGGACCGCATGTACTGGCGCGACACGAACACCGGGCGTCTGT
GGCTGCCAAACACCCCCGACCCCCAAAAACCACCGCGCGGATTTCTGGCGCCGCC
GGACGAACTAAACCTGACTACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGC
GCTTTTGTTTTGTATTGGTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGAC
CTGCAGAAATTGATGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTT
CCTGTCATACTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAG
GATTGGAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTA
CTGAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATTTA
AACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCTATAGAT
CTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTGTGGTTCTAAG
TACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACGAGATCAGCAGCCT
CTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCATCAGAA
GCTAATTC
TACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAG
CAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACA
TTCCACATCCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGC
GCCACCTTCTACTCCTCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCG
CGTCGTGCAGGACGTGACAAATGGAAGTAGCACGTCTCACTAGTCTCGTGCA
GATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGGCCTTTGGGGCAGCGG
CCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGGAAGGGGTG
GGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCGAAGG
TCCTCCCGAGGCCCGGCATTCTCGCACGCTTCAAAAGCGCACGTCTGCCGCGC
TGTTCTCCTCTTCCTCATCTCCGGGCCTTTCGACCTGCAGCGACCCGCTTAACA
GCGTCAACAGCGTGCCGCAGATCTTGGTGGCGTGAAACTCCCGCACCTCTTC
GGCCAGCGCCTTGTAGAAGCGCGTATGGCTTCGTACCCCTGCCATCAACACG
CGTCTGCGTTCGACCAGGCTGCGCGTTCTCGCGGCCATAACAACCGACGTAC
GGCGTTGCGCCCTCGCCGGCAACAAAAAGCCACGGAAGTCCGCCTGGAGCAG
AAAATGCCCACGCTACTGCGGGTTTATATAGACGGTCCCCACGGGATGGGGA
AAACCACCACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGT
CTACGTACCCGAGCCGATGACTTACTGGCGGGTGTTGGGGGCTTCCGAGACA
ATCGCGAACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGG
CCGGGGACGCGGCGGTGGTAATGACAAGCGCCCAGATAACAATGGGCATGC
CTTATGCCGTGACCGACGCCGTTCTGGCTCCTCATATCGGGGGGGAGGCTGG
GAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCA
TCGCCGCCCTCCTGTGCTACCCGGCCGCGCGATACCTTATGGGCAGCATGACC
CCCCAGGCCGTGCTGGCGTTCGTGGCCCTCATCCCGCCGACCTTGCCCGGCAC
AAACATCGTGTTGGGGGCCCTTCCGGAGGACAGACACATCGACCGCCTGGCC
AAACGCCAGCGCCCCGGCGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTC
GCCGCGTTTATGGGCTGCTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGG
GTCGTGGCGGGAGGATTGGGGACAGCTTTCGGGGGCGGCCGTGCCGCCCCAG
GGTGCCGAGCCCCAGAGCAACGCGGGCCCACGACCCCATATCGGGGACACGT
TATTTACCCTGTTTCGGGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTAT
AACGTGTTTGCCTGGGCTTTGGACGTCTTGGCCAAACGCCTCCGTCCCATGCA
TGTCTTTATCCTGGATTACGACCAATCGCCCGCCGGCTGCCGGGACGCCCTGC
TGCAACTTACCTCCGGGATGGTCCAGACCCACGTCACCACCCCAGGCTCCAT
ACCGACGATCTGCGACCTGGCGCGCACGTTTGCCCGGGAGATGGGGGAGGCT
AACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC
AATAAAAAGACAGAATAAAACGCACGGGTGTTGGGTCGTTTGTTCATAAACG
CGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGACCCCAT
TGGGACCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCAACCCCCAAGTTC
GGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCAAGCCCTGCCAT
AGCCACGGGCCCCGTGGGTTAGGGACGGGGTCCCCCATGGGGAATGGTTTAT
GGTTCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGG
ACTGAGCAGACAGACCCATGGTTTTTGGATGGCCTGGGCATGGACCGCATGT
ACTGGCGCGACACGAACACCGGGCGTCTGTGGCTGCCAAACACCCCCGACCC
CCAAAAACCACCGCGCGGATTTCTGGCGCCGCCGGACGAACTAAACCTGACT
ACGGCATCTCTGCCCCTTCTTCGCTGGTACGAGGAGCGCTTTTGTTTTGTATTG
GTCACCACGGCCGAGTTTCCGCGGGACCCCGGCCAGGACCTGCAGAAATTGA
TGATCTATTAAACAATAAAGATGTCCACTAAAATGGAAGTTTTTCCTGTCATA
CTTTGTTAAGAAGGGTGAGAACAGAGTACCTACATTTTGAATGGAAGGATTG
GAGCTACGGGGGTGGGGGTGGGGTGGGATTAGATAAATGCCTGCTCTTTACT
GAAGGCTCTTTACTATTGCTTTATGATAATGTTTCATAGTTGGATATCATAATT
TAAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTCATGATCT
ATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTTG
TGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACG
AGATCAGCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAA
GTTCTAATTCCATCAGAAGCTAGCTT
GGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGA
AAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCG
CCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAG
TTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTAC
GCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCTCAGTACAATCT
GCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCT
GACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGC
TGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCAC
CGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTT
AATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGG
AAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATA
TGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGA
AAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTT
TTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA
AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAA
CTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACG
TTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTAT
CCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCT
CAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGA
TGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATA
ACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTA
ACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTG
GGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGA
TGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTA
CTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAA
AGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG
CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCA
CTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGG
GAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTG
CCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATA
CTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAA
GATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGT
TCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGAT
CCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCT
ACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGA
AGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTG
TAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATA
CCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT
CGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAG
CGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAAC
GACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCA
CGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTC
GGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCT
TTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGT
GATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC
TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCC
TGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAG
CTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGC
GAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTG
GCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGG
GCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCC
CAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAG
CGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAA

Good luck,

Chris Paszty
 







								Dec 1995
Gene targeters:

A couple of years ago I sent out the sequence compilations of the PGKneo
and PGKtk cassettes that make up pPNT [Tybulewicz et al. Cell vol 65
p1153-1163 (1991)] with the goal of making it easier for people to
construct targeting vectors using these 2 cassettes and to design screening
strategies for identifying correctly targeted ES cell clones.  The purpose of
this follow up note is to address the issue of DNA rearrangement that can
be encountered during vector construction.


A good way to build one's targeting vector using pPNT has been to clone
the short arm into the polylinker that is located between the PGKneo and
PGKtk cassettes and to then clone the long arm into the unique XhoI site
that lies on the other side of the PGKneo cassette.  The final targeting
vector can then be linearized at the unique NotI site.  With regards to the
effectiveness of negative selection by PGKtk in mammalian cells this
configuration of the short and long arms as well as the linearization by
NotI is ideal for two reasons.  First, the distance between the PGKneo
and PGKtk cassettes is minimized thereby making it more unlikely for
events (such as endonuclease attack) other than homologous recombination
to separate the two markers.  Second, by linearizing with NotI the
pUC/Bluescript region of the vector is left flanking the PGKtk cassette
thereby decreasing the probability of PGKtk being inactivated by
exonucleases.

When building my first targeting vector I found that most (99%+) of the
clones that were recovered after the last ligation step (cloning the long arm
into the XhoI site) contained deletions and rearrangements.  From talking
to a number of people this seemed to be a fairly common occurrence when
including both PGKneo and PGKtk in ones targeting construct.  The
unrearranged clone that I finally isolated turned out to be totally stable
even when grown for many "passages".  When miniprep DNA from
this clone was retransformed into bacteria no rearrangement was observed.
This seemed to indicate that the rearrangement problem was not due to
the particular murine sequences that I had included in my targeting vector
but was more likely due to the topology of the transforming DNA.
Since I had used calf intestinal phosphatase (CIP) to dephosphorylate the
XhoI ends of my XhoI cut short arm vector (to eliminate vector religation)
the topology of DNA in my ligation mix was OC (open circular) containing
dephosphorylated nicks.  From the subsequent construction of a number
of targeting vectors based on pPNT and a 2 tk version of pPNT (pPN2T)
it is now clear that by not CIP treating the short arm vector during the
cloning in of the long arm, the incidence of rearrangement is reduced to
almost zero, thereby making it much easier to obtain the final targeting
vector.


With regards to vector religation without the CIP treatment one can still
use the XhoI site for cloning in the long arm by playing with the
insert-vector ratio to minimize vector religation.  Alternatively, one
could eliminate vector religation without using CIP and also get
directional cloning of the long arm using the NotI and XhoI sites in
pPNT, but because these two sites overlap in pPNT, achieving
effective double digestion was thought to not be possible (93' NEB
catalogue p 180).  Recently the people at NEB (Moreira and Noren,
Biotechniques 1995 vol 19 p56-59; Minimum Duplex Requirements for
Restriction Enzyme Cleavage Near the Termini of Linear DNA
Fragments) have reexamined the overlapping restriction enzyme site
issue and their new results indicate that it should be possible to achieve
effective double digestion of the NotI and XhoI sites in pPNT and pPNT
derivatives by first cutting with NotI and then subsequently with XhoI.
So although we haven't tried it , using NotI and XhoI may be a realistic
option for the cloning in of the long arm.


Another approach which we've been using successfully and prevents
vector religation as well as allowing for forced directional cloning of the
long arm is as follows:

The recognition site for a fairly new 8 cutter, Sse8387I (CCTGCAGG,
available from Amersham), is located between the NotI site and the
PGKneo cassette in both pPNT and pPN2T.  By double digesting the
short arm-containing targeting vector with NotI and Sse8387I and then
gel purifying it one can eliminate vector religation.  The different cohesive
ends also allow for the directional cloning of the long arm.

There are various straightforward approaches for creating a NotI site and
an Sse8387I site at either end of ones long arm:

- if one is using PCR to obtain the long arm then it is easy to just include
a NotI site on the 5' end of one of the primers and an Sse8387I site on
the 5' end of the other primer.  TA cloning of the product leaves one with
a long arm that is ready to clone into one's short arm-containing vector.

- another approach involves creating a blue/white vector that has a blunt
end cloning site in-between a NotI site and an Sse8387I site.  The long
arm can then be blunt end cloned in both orientations into this
intermediate vector.  The proper orientation clone leaves one with a long
arm that is ready to clone into one's short arm-containing vector.
To make a blue/white NotI-Sse8387I intermediate vector one can modify
the polylinker of any common blue/white vector using custom oligos.
Alternatively one can combine complementary fragments from two
different blue/white vectors...the 1892 bp XbaI-AlwNI fragment from
pUC18 (polylinker contains an Sse8387I site) and the 833 bp XbaI-AlwNI
fragment from pBluescript SK +/- (polylinker contains a NotI site) can be
combined to create such a vector (pUCNotSse).  This hybrid blue/white
vector has a HincII site (blunt end cutter) in-between the NotI site and the
Sse8387I site.

pUCNotSse polylinker:
gagctccaccgcggtggcggccgctctagagtcgacctgcaggcatgcaagctt


Over the past year, using the sequence compilations of PGKneo and
PGKtk as well as the NotI-Sse8387I long arm cloning strategy, we've
significantly increased the speed and ease with which we build our targeting
vectors.

Hope this information is useful to others.



Chris Paszty
Lawrence Berkeley Laboratory
C_Paszty at csa2.lbl.gov






More information about the Methods mailing list