Aedes

graciela panzetta gpan at FCQ.UNCOR.EDU
Fri Mar 1 09:51:57 EST 1996


Hello! I'm looking forward to amplify mtDNA of Aedes albifasciatus with 
the following primers

 TL2-J-3037 (alias A-t-LEU): ATGGCAGATTAGTGCAATGG
 C3-N-5460 (alias CO 3b): TCAACAAGTGTCAGTATCA

I should like to know if these primers have already been used in these 
genera?

Otherwise, is there a pair of primers suitable for mtDNA PCR/RFLP?

Thanks in advance!   





More information about the Methods mailing list