LambdaGEM-11 vector - Kpn sites

[Michelle Gleeson]

G'day all,

I have constructed a genomic library using the Promega LambdaGEM-11 Xho1
half site arms vector.  I am attempting to generate restriction maps for
the postive clones I have isolated so far.  I have done Sac1 digests to
estimate the sizes of the inserts, which give the 9 and 20kb arm fragments
+ insert fragments.  I have also done Kpn1 digests and double digests
with Sac and Kpn.
I have looked up the EMBL3 map in the paper by Frischauf et al (1983) and
it indicates that there are 2 Kpn1 sites in the vector, but I do not know
where they are located in relation to the left and right arms.  The major
fragments generated on the digest gel are large, do not resolve well, and
I would  only be guessing their size.

Has anyone else done this, or have restriction maps of the uncut vector?
Or can anyone suggest a better strategy?

Thanks in advance,

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit     Ph  (02)95144043
University of Technology        Fax (02)95144003
Sydney AUSTRALIA
michelle.gleeson at uts.edu.au
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT