PCR artifact induced by a base change in a primer

Gary Truett GaryTruett at POSTOFFICE.PBRC.EDU
Sun Sep 22 10:04:18 EST 1996


Thanks Brett, but let me clarify.
The error is not in the primer, it is in the first or second base after the
primer.  

This problem may be difficult to explain without looking at the gels, but I
bet somebody out there has seen it before.  The reason it is important is
that some investigators use base changes in a primer to create restriction
sites that depend on a mutation that occurs in the outside the primer
region.  These assays are used to genotype individuals.  In such assays, it
may be necessary to optimize PCR conditions not only for yield and
specificity of product, but also to minimize this type of artifact.

For example, in the primer below, the C under the * does not match the T
that occupies that the same position in genomic DNA.  We made this change
intentionally to create a restriction site that would be abolished by a t>g
mutation that follows immediately after the primer.  The wildtype has a t
and the mutant has a g.  We think the problem is occurring at the site of
the mutation, the t or g site.  
                                            *
Forward primer      5'  AGCACCATTTCCACTTCAATCTC 3'
wildtype genomic DNA 3' TCGTGGTAAAGGTGAAGTTATAGtccactttata...  5'
                                               ^site of mutation from t to g
mutant genomic DNA   3' TCGTGGTAAAGGTGAAGTTATAGgccactttata...  5'

When we amplify using the primer above, we generate a DdeI site (CTNAG) in
the wildtype DNA, but not in the mutant DNA.  And yet, the mutant DNA
sometimes cuts partially, as if the appropriate site were being created in a
fraction of the amplicons by random incorporation of bases.

There is also an Msp I (GGCC) site that is created by the t>g mutation.
The T>C base change in the primer should not affect that MspI site.
The wildtype should not cut with Msp I and the mutant should cut completely. 
However, under some amplification conditions, the wildtype DNA cuts when it
should not and the mutant cuts only partially.  Purifying the primers on
polyacrylamide gels does not fix the problem.  Lowering the annealing
temperature from 65 to 55 does appear to fix it.  

For this particular example we have also tested a forward primer that is the
same as the one above, except that the base change in the primer is not
made; the native sequence is used instead.  The wildtype DNA amplified with
either primer should not cut with Msp I.  But, the primer that has the
altered base produces a wildtype product that cuts partially with MspI. 
This experiment suggests that altering a base in the primer can create an
artifact several bases  away.


One of the interesting things about this artifact is that it is
inconsistent.  Some DNA samples may show the artifact, while others do not. 
The same samples may may the artifact under some PCR conditions, but not
under others.  



>>We have experienced a peculiar PCR artifact and are seeking comments from
>>others who may have had similar results.  Any references that address the
>>problem would be appreciated.
>>
>>Our objective is to develop assays for genotyping mice that carry a
>>particular mutation.  The mutation affects no restriction sites, so we chose
>>to create a restriction site by altering a single base in one of the
>>primers.  We used GCG to identify a single base change that would generate a
>>restriction site that occurs in the wildtype DNA, but is lost in the mutant
>>DNA.  
>>
>>PCR amplification generates a single product of the appropriate size.
>>The wildtype DNA should cut to completion, but only cuts partially.
>>Even more surprising is that the mutant DNA, which should not be cut at all,
>>cuts partially.
>>
>>We have ruled out contamination of the reagents as a cause.
>>
>>We have also ruled out the restriction endonuclease as the culprit.
>>
>>Furthermore, we get similar results with different primers that amplify
>>completely different targets.
>>
>>Lowering annealing temperature sometimes appears to resolve the problem.
>>
>>Our current theory is that the base substitution in the primer causes the
>>wrong base to be incorporated at the site of the mutation (which is 1 to 4
>>bases away).
>>
>>Is anyone familiar with this problem?
>
>Sure, I have seen cloned PCR products with errors in the primed region. The
>chemistry of primer synthesis can lead to all kinds of errors, but misincorp-
>oration is relatively rare. Internal deletions and incomplete synthesis is
>more common. You could always gel purify your primers. Double check the
>order and spec sheets for proper sequence input, if they are wrong
>re-synthesize it. Otherwise, pick more clones to begin with and sequence
>through the primed DNA.
>
>
>Brett Lindenbach
>    
>Program in Immunology                              
>Washington University - St Louis                  
>brett at borcim.wustl.edu                             
>
>"I own my own pet virus. I get to pet and name her." - Cobain
>
>
Assays for Murine Obesity Mutations

G. E. Truett, J. A. Walker and D. B. West

Pennington Biomedical Research Center, Baton Rouge, Louisiana 70808.

Short title:  assays for obesity mutations 
Keywords: leptin, leptin receptor, carboxypeptidase E, diabetes

Correspondence and page charges should be sent to:
Gary E. Truett
Pennington Biomedical Research Center
6400 Perkins Road
Baton Rouge, LA 70808-4124
phone 504 763-2665
fax 504 763-2525
email pntrue at unix1.sncc.lsu.edu
The genes affected by the obesity mutations obese (Lepob), diabetes
(Leprdb), fatty (Leprfa), fat (Cpefat) and tubby (tub) have all been cloned
and sequenced (Zhang et al 1994, Chen et al 1996, Lee et al 1996, Iida et al
1996, Phillips et al, 1996, Naggert et al 1996, Noben-Trauth et al 1996,
Kleyn et al 1996), making it possible to develop accurate assays for
genotype of animals in populations segregating these mutations. 
Identification of genotype facilitates animal husbandry, early prediction of
mature phenotype and drawing inferences regarding specific genotype groups
(wildtype, heterozygote and mutant) as opposed to phenotype groups (lean and
obese).  We have developed a set of assays for each of these mutations to
meet these needs.
One popular method of detecting known mutations entails PCR amplification of
the genomic region that includes the affected base, followed by digestion of
the amplicon with a restriction endonuclease that cuts either wildtype DNA
or mutant DNA. When the mutation affects no known restriction sites, novel
restriction sites often can be created by altering the sequence of a PCR
primer that anneals near the site of the mutation.  In some cases it is even
possible to create dual  assays with a single base change in one primer,
such that one restriction endonuclease cuts wildtype DNA specifically, and
another cuts mutant specifically.  When this is possible, either assay may
be used to genotype animals, but running both assays provides greater
assurance that the genotypes are correct.
Our strategy for identifying appropriate base substitutions depended on the
Wisconsin Sequence Analyis Package (Genetics Computer Group, Madison, WI). 
This software includes a map function that identifies restriction sites in a
DNA sequence, and an option, called mismatch, that identifies restriction
sites that can be created by altering a single base in the specified
sequence.  By comparing the lists of potential restriction stes compiled for
wildtype and mutant sequences, we found that a few sites were unique to
either wildtype or mutant sequences.  The base changes required to create
these unique sites were identified; when one substitution was found to
create different restriction sites in wildtype and mutant sequences, that
base substitution was selected for further study.  Only one  target did not
meet these criteria; Cpefat required the design of two separate reverse
primers to produce two assays.
Once appropriate base substitutions were identified, primers flanking the
mutation sites were designed using Oligo 5.0 (   ).  All of the base
substitutions happened to be located in the regions where the reverse
primers would be derived.  Therefore, reverse primers were designed to
anneal beginning at the base next to the one affected by the mutation.  A
forward primer was then selected to match the reverse primer.  After
designing the primers, the base changes previously identified were made to
the reverse primers, and primers were ordered from a commercial source
(BioSource International, Camarillo, CA).  
Two of these obesity mutations, Lepob and Leprfa, create restriction sites
unique to mutant DNA.  In the assays described here, a single base change in
the reverse primer conserves the Dde I restriction site created by Lepob and
creates a Bfa I site in wildtype DNA. The MspI site created by Leprfa is
abolished by the base substitution in the primer, and is replaced by  a Pvu
II site in wildtype DNA and a Aci I site in mutant DNA.  The three remaining
mutations, Leprdb, Cpefat and tub, do not affect restriction sites.  But,
base substitutions in the reverse primers of Leprdb and tub create
restriction sites unique to both the wildtype and mutant DNA sequences. 
Cpefat was the only mutation we were unable to create two assays for with a
single primer pair.  Instead, two separate amplifications were designed. 
They use the same forward primer, but different reverse primers to create
two assays.  These assays are are simple enough to be useful to
investigators with limited equipment, but may also provide the basis for
automated assays. 


REFERENCES

Kleyn, P. W., Fan, W., Kovats, S. G., Lee, J. J., Pulido, J. C., Wu, Y.,
Berkemeier, L. R., Misumi, D. J., Holmgren, L., Charlat, O., Woolf, E. A.,
Tayber, O., Brody, T., Shu, P., Hawkins, F., Kennedy, B., Baldini, L.,
Ebeling, C., Alperin, G. D., Deeds, J., Lakey, N. D., Culpepper, J., Chen,
H., Glucksmannkuis, M. A., Carlson, G. A., Duyk, G. M., Moore, K. J. 
(1996).  Identification and characterization of the mouse obesity gene
tubby: A member of a novel gene family.  Cell 85, 281-290.
Naggert, J. K., Fricker, L. D., Varlamov, O., Nishina, P. M., Rouille, Y.,
Steiner, D. F., Carroll, R. J., Paigen, B. J., Leiter, E. H.  (1995). 
Hyperproinsulinaemia in obese fat/fat mice associated with a
carboxypeptidase E mutation which reduces enzyme activity.  Nature Genetics
10, 135-142.
Noben-Trauth, K., Naggert, J. K., North, M. A., Nishina, P. M.  (1996).  A
candidate gene for the mouse mutation tubby.  Nature 380, 534-538.
Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J. M.
(1994).  Positional cloning of the mouse obese gene and its human homologue.
Nature 372, 425-432.
Chen, H., Charlat, O., Tartaglia, L. A., Woolf, E. A., Weng, X., Ellis, S.
J., Lakey, N. D., Culpepper, J., Moore, K. J., Breitbart, R. E., Duyk, G.
M., Tepper, R. I., Morgenstern, J. P.  (1996)  Evidence that the diabetes
gene encodes the leptin receptor: identification of a mutation in the leptin
recpetor gene in db/db mice.  Cell 84: 491-495.
Lee, Gwo-Hwa, Proenca, R., Montez, J. M., Carroll, K. M., Darvishzadeh, J.
G., Lee, J. I., J. M. Friedman.  (1996)  Abnormal splicing of the leptin
reeptor in diabetic mice.  Nature 379: 632-635.
Iida, M., Murakami, T., Ishida, K., Mizuno, A., Kuwajima, M., Shima, K. 
(1996).  Phenotype-linked amino acid alteration in leptin receptor cDNA from
Zucker fatty (fa/fa) rat.  Biochem Biophys Res Commun 222, 19-26.
Phillips, M. S., Liu, Q. Y., Hammond, H. A., Dugan, V., Hey, P. J., Caskey,
C. T., Hess, J. F.  (1996).  Leptin receptor missense mutation in the fatty
Zucker rat.  Nat Genet 13, 18-19.
Table 1.  Summary of amplification conditions for murine obesity mutation assays
Locus
Primer
Sequence*
Amplification Conditions
Size (bp)
Lepob
Lep276F
Lep389R
aagatggaccagactctggc
CAgCAgATggAggAggTCTA
2 min at 95(, 30 cycles of 30 sec at 95(, 45 sec  at 60(
114
Leprfa
rLeprF
rLeprR
CGTATGGAAGTCACAGA
GAATTCTCTAAATATTTCAGC
2 min at 95(, 30 cycles of 30 sec at 95(, 30 sec at 55(, 30 sec at 72(
101
Leprdb
mLeprF
mLeprR
CGGACACTCTTTGAAGTCTCTCA
CATTCAAACCATAGTTTAGGTTTGGTT
2 min at 95(, 30 cycles of 30 sec at 95(, 45 sec  at 60(
131
tub
tubF
tubR
TGTTAGCACGCTGGCAGA AAACAGGGAGTGGCAACACTCG
2 min at 95(, 30 cycles of 30 sec 95(, 30 sec  65(
182
Cpefat
CpeF
CpeRA 
CpeRB
CAGCTTGCCCCCGAGACCAAGG
AAGGTCTCCTCCGTGCAGATTGGTCG
AAGGTCTCCTCCGTGCAGATTGGCCG
2 min at 95(, 30 cycles of 30 sec at 95(, 45 sec  at 60(
90
* Underlined bases are those that are altered to create the restriction
sites.  Primers were mixed at 200 nM each with 50 mM KCl, 10 mM Tris-HCl (pH
9 at 25o), 0.1% Triton X-100, 1.5 mM MgCl2, 0.2 mM each dATP, dCTP, dGTP,
and dTTP, 0.3U Taq polymerase and 200 ng genomic DNA in a 25 ml volume. 
Target DNA was amplified in a PTC-100 thermal controller (MJ Research, Inc.,
Watertown, MA) under amplification conditions described above.


Figure 1.  Detection of restriction fragment length polymorphisms created by
assays of murine obesity mutations.  A) Primers mLeprF and mLeprR amplify a
131 bp product (lane 1).  Nla IV cuts wildtype DNA into 105 and 26 bp
fragments and does not cut mutant DNA (lanes 2-4).  BstE II cuts mutant  DNA
into 102 and 29 bp fragments and does not cut wildtype DNA (lanes 5-7).  B) 
Primers rLeprF and rLeprR amplify a 101 bp product (lane 1).  Pvu II cuts
wildtype DNA into 105 and 26 bp fragments and does not cut mutant DNA (lanes
2-4).  Aci II cuts mutant DNA into 102 and 29 bp fragments and does not cut
wildtype DNA  (lanes 5-7).  C)  Primers LepF and LepR amplify a 114 bp
fragment (lane 1).  Bfa I cuts wildtype DNA into 94 and 20 bp fragments and
does not cut mutant DNA (lanes 2-4).  Dde I cuts wildtype DNA into 93 and 21
bp fragments.  D)  Primers tubF and tubR amplify a 181 bp fragment (lane 1).
BstU I cuts wildtype DNA into 160 and 22 bp fragments and does not cut
mutant DNA (lanes 2-4).  Taq Ia cuts mutant DNA into 160 and 22 bp fragments
(lanes 5-7).  E) Primers CpeF and CpeRA amplify a 90 bp fragment (lane 1).
Taq Ia cuts wildtype DNA into 64 and 36 bp fragments and does not cut mutant
DNA (lanes 2-4).  Primers CpeF and CpeRB amplify a 90 bp fragment (lane 5). 
Msp I cuts mutant DNA into X and X bp fragments and does not cut wildtype
DNA  (lanes 6-8).  Assay conditions: PCR products (1or 2 ml) were cut in 20
ml volumes for 1-3 hours with restriction endonucleases obtained from New
England Biolabs (Beverly, MA).  Four ml of 15% ficoll/0.25% bromophenol blue
were mixed with each sample.  Ten ml of the product were electrophoresed
through a X cm 12% vertical polyacrylamide gel at 15 volts for 1.5 hours in
1X TBE.  Gels were stained in  1X TBE containing 1.0 mg ml-1 ethidium
bromide and illuminated with UV light.  Images were captured as TIFF files
via a CCD camera and AMBIS Image Acquisition & Analysis software (San Diego,
CA). 








More information about the Methods mailing list