Help! Problem with Northern Blots!

Michelle Gleeson michelle at MOLECULE.BIO.UTS.EDU.AU
Wed Apr 9 18:15:50 EST 1997


Hi Joy,

If the area which is black is the bit that is in direct contact with the
solutions, perhaps you could fix it by sandwiching the membrane between 2
meshes before rolling it up?

Another thing is, have you changed the type of mesh recently?  We had a
similar problem with increase in background, and going back to the
original Hybaid mesh fixed it.  The cheaper plastic stuff we tried had
deteriorated,  and suddenly stopped working.

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit          Ph  (02)95144043
University of Technology             Fax (02)95144003
Sydney, AUSTRALIA                    michelle.gleeson at uts.edu.au
When you get to the end of your rope, tie a knot and hang on - FDR
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT

On Wed, 9 Apr 1997, Joy Buckle wrote:

>
> I have been carrying out Northern blots for the last six months and the
> lab tech here has been doing them for 2 or 3 years.  Things up until now
> were fine but in the last month or so we have been producing blots that
> are literally half black (full of radioactivity) and half normal. For
> example, today I developed a membrane from a large gel.  The bottom lanes
> were perfect but the top half was simply black.  It was impossible to even
> determine where the lanes were. This is why it is so puzzling.  We are
> using nylon membranes and prehybridizing for 4 hours in Denhardt's, SDS,
> SSC and Salmon Sperm DNA.  This is being carried out in a hybridization
> oven @ 42 C in the bottles.
>
> Only one membrane is contained in each bottle. We then hybridize overnight
> with the DS probe @ 42 C again.  The one thing I did notice this time was
> that when I rolled the membrane and the nylon mesh into a tight spiral to
> place it into the bottle, the part of the membrane that turned out to be
> black was the part that was directly exposed to the solutions (i.e. facing
> the interior of the bottle).
>
> This was working fine before using all the same recipes for the solutions
> used.  Anyway have any ideas what could be wrong?  We've asked evryone
> here in the dept but no one has seen or heard anything like this before.
> We even contacted Mandel, the producers of NYTRAN- the nylom membrane that
> we are using)  but to no avail.
>
>
> Any suggestions?   Please email jbuckle at ganymede.cs.mun.ca
>
> Thanking you in advance,
> Joy
>
>
>




More information about the Methods mailing list