What orange or yellow dye to use in DNA electrophoresis?

[Michelle Gleeson]

Hi David,
I make a tri colour dye using bromphenol blue, xylene cyanol, and orange
G.  The orange G runs about 50bp on the gel, and I just added the same
quantity as for the other dyes.  Our haematology/cytology lab had it, so
that would be a good place to start looking.  I think I got the recipe
from the Promega catalogue, who sell a pre made tri colour dye.

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit              Ph: (02) 9514 4043
University of Technology                 Fax:(02) 9514 4003
Westbourne St Gore Hill, NSW 2065        michelle.gleeson at uts.edu.au
When you get to the end of your rope, tie a knot and hang on - FDR
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT

On 27 Aug 1997, David N. Levy wrote:

> I cannot remember which yellow or orange dyes can be used to make a
> loading buffer for agarose electrophoresis. I thought it was acridine
> orange, but my acridine orange from Sigma fluoresces a lot.  But they
> list it in the nucleic analysis section of their catalog.  What gives?
> Thanks.
>
>
>
> David N. Levy
> University of Alabama at Birmingham
> Birmingham, AL 35294-0007
>
> levy at uab.edu
>
>