IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

DNA-free RNA

Michelle Gleeson michelle at MOLECULE.BIO.UTS.EDU.AU
Mon Feb 10 16:26:44 EST 1997


Hi Francois,

Have you tried a different brand of RNAse free DNAse?  I had no problems
with Promega's RQ1 enzyme, and I am sure there have been posts here before
about problems with some brands.  No affiliations, etc

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit          Ph  (02)95144043
University of Technology             Fax (02)95144003
Sydney, AUSTRALIA                    michelle.gleeson at uts.edu.au

When you get to the end of your rope, tie a knot and hang on - F Roosevelt
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT

On Mon, 3 Feb 1997, Francois Hatey wrote:

> Dear Netters,
>
> Does somebody knows a good method to get undegraded RNA without DNA ?
> (we want to analyze these RNAs by RT-PCR and they are prepared from
> either tissues or cultured cells)
>
> Classical method involves digesting by RNAse free-DNAse, but we get
> some RNA hydrolysis with this enzyme. Any advice ?
> What about alternative techniques such as lithium chloride precipitation
> associated with guanidium thiocyanate/phenol extraction (as described by
> Patanjali et al, PNAS 88, 1943-47, 1991) or something like that ?
>
> Thanks in advance :-)
>
> Francois Hatey
>
> Laboratoire de Genetique Cellulaire, INRA
> Centre de Recherches de Toulouse, BP 27
> 31326 Castanet-Tolosan Cedex, France
>
> hatey at toulouse.inra.fr
>
>




More information about the Methods mailing list

Send comments to us at biosci-help [At] net.bio.net