Operon primer sequences

Dr Alok Adholaya aloka at teri.ernet.in
Thu Feb 13 07:20:33 EST 1997


Hi,

OPAM-19    CCAGGTCTTC
OPAL-07    CCGTCCATCC 

Hope this helps

ALOK

ATGGATGAGCCAAGACGCATAGAGACAGATGACAGATAGGATAGGATAGGGCCTGAGACTACGCTAG
                        \\  // \\          // \\  // \\
 Dr. Alok Adholeya        \\': | \\      // | :,\\': | \\
 Fellow                     \\ | | \\  // | | //  \\ | | \\
 Microbial Biotechnology div  \\ | :,\\': | //      \\ | :,\\
 TATA Energy Res Inst,
 Habitat Pl, Lodi Rd, New Delhi, 110003, INDIA,
 Tel:+11-4622246,  Voice/ext:2609,      FAX:+11-4621770/4632609
 Web site: http://www.teriin.org
GTAGCGATTCGAGCTAGCGATCGGATTGGCGATCGAGCTAGCTAGCGCTATCGAGCTAGCGATCGAA
             "NO AFFILIATIONS NO ENDORSMENTS"





More information about the Methods mailing list