blotting acrylamide gels

Michelle Gleeson michelle at MOLECULE.BIO.UTS.EDU.AU
Tue Feb 25 15:29:44 EST 1997


Hi Julie,

The following reference should help you:

Takeuchi, M and Fujisawa, H.  (1995) "Contact Transfer Method:  DNA
transfer from polyacryalmide gel"  Analytical Biochemistry Vol 224 p
611-612    Good luck!

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit          Ph  (02)95144043
University of Technology             Fax (02)95144003
Sydney, AUSTRALIA                    michelle.gleeson at uts.edu.au

When you get to the end of your rope, tie a knot and hang on - FDR
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT

On Tue, 25 Feb 1997, Constable Julie Lynn wrote:

> Does anyone have a protocol for blotting DNA from an acrylamide gel onto a
> nylon membrane?  I seem to recall that it is a fairly simple procedure,
> like putting a moistened membrane on top of the gel with some weight on
> top.  Any ideas would be greatly appreciated.
>
> Julie Constable
> Dept. of EPO Biology
> U. of Colorado, Boulder
>
>
>




More information about the Methods mailing list