PCR subcloning

Michelle Gleeson michelle at MOLECULE.BIO.UTS.EDU.AU
Wed Jan 8 19:48:24 EST 1997


Hi Jillian,

I believe Promega have just released a new T vector kit that enables the
insert to be easily removed after cloning.  It is called pGEM T Easy
vector (or something like that)  As for the percentage of PCR products
with A tails, I have never had a problem with not getting the clone I
want, but others have said you can incubate the products with excess dATP
in the presence of Taq to get a higher proportion

Good luck

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit          Ph  (02)95144043
University of Technology             Fax (02)95144003
Cnr Westbourne St and Pacific Hwy    michelle.gleeson at uts.edu.au
Gore Hill, NSW 2065 AUSTRALIA

When you get to the end of your rope, tie a knot and hang on - F Roosevelt
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT

On 8 Jan 1997, Jillian Johnston wrote:

> I was about to ask the same question myself today!  I would like
> to subclone my Taq-generated PCR product into a vector that will not be its
> final resting place (its a long story).  I was advised to use a
> T-vector which I dutifully made (very easy and cheap) and when
> faced with trying to determin vector:insert ratio aI thought it
> would be important to know just what % of the insert actually has
> a single 'A' on each end.  To my dismay I read that one could
> expect something like 9% to be what I wanted for cloning.  Is
> this really the case and if so why go to the trouble of using
> T-tailed vectors if most of the PCR product is blunt-ended?  I've
> gone ahead with it anyway but would like some advice for the next
> time I do this which will probably be in a couple of days.
> Thanks
>
> --
> Jillian Johnston
> Dept. of Biological Sciences       Guider
> Univ. of Calgary         	   30 Pathfinders, Tanisi District
>
>
>




More information about the Methods mailing list