reliable colony screening w/PCR?
Michelle Gleeson
michelle at MOLECULE.BIO.UTS.EDU.AU
Sun Jun 1 18:18:24 EST 1997
Hi Steve,
This is my (almost) foolproof recipe:
1. Use a wooden toothpick or cocktail stick (birch or bamboo, not pine)
and touch colony lightly.
2. Put a dab on a fresh plate for storage purposes.
3. Touch the same colony again and swirl it well into 100ul of sterile water
in a 0.5ml tube. The suspension should not be distinctly turbid.
4. Boil this tube for 5 min and then plunge into an ice slurry to snap
chill.
5. Take 5ul of the suspension and use in a 50ul PCR reaction, same
conditions as when product was amplified.
Tips: You can cut the cycles back to speed things up.
The suspension does not keep, so make it just before you want it.
Using plasmid universal primers also works, and is good for screening
colonies of different PCRs at the same time. (just take distance from
insert into account when calculating insert size.)
AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit Ph (02)95144043
University of Technology Fax (02)95144003
Sydney, AUSTRALIA michelle.gleeson at uts.edu.au
When you get to the end of your rope, tie a knot and hang on - FDR
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
On 31 May 1997, Steven Sullivan wrote:
>
>
> Could someone post a reliable method (or Biotechniques citation for same)
> for rapid screening of bacterial colonies via PCR? You know, one of those
> methods where you touch the colony with a toothpick or pipette tip and
> swirl it into the PCR reaction. Thanks.
>
>
>
>
More information about the Methods
mailing list