reliable colony screening w/PCR?

Joe Boutell boutell at cf.ac.uk
Fri Jun 13 09:42:04 EST 1997


Hiya!
I find sterile pipette tips (p100-200) to be fine for picking colonies. I 
usually streak the colonies onto a fresh plate, and pick from this streak 
the next day into 10ul sterile water in a 0.5ml tube, and boil for 10 
min. Use 1-2ul of this as template in PCR. However I have also found that 
i can do without the intermediate streak, by using 5ul of the boiled 
colony prep to retransform the bugs. Seems there's still viable plasmid 
in there even after boiling.
Cheers,
Joe Boutell






michelle at MOLECULE.BIO.UTS.EDU.AU (Michelle Gleeson) wrote:
>Hi Steve,
>
>This is my (almost) foolproof recipe:
>
>1. Use a wooden toothpick or cocktail stick (birch or bamboo, not pine)
>and touch colony lightly.
>2. Put a dab on a fresh plate for storage purposes.
>3. Touch the same colony again and swirl it well into 100ul of sterile water
>in a 0.5ml tube. The suspension should not be distinctly turbid.
>4. Boil this tube for 5 min and then plunge into an ice slurry to snap
>chill.
>5. Take 5ul of the suspension and use in a 50ul PCR reaction, same
>conditions as when product was amplified.
>
>Tips:  You can cut the cycles back to speed things up.
>The suspension does not keep, so make it just before you want it.
>Using plasmid universal primers also works, and is good for screening
>colonies of different PCRs at the same time. (just take distance from
>insert into account when calculating insert size.)
>
>AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
>Michelle Gleeson
>Molecular Parasitology Unit          Ph  (02)95144043
>University of Technology             Fax (02)95144003
>Sydney, AUSTRALIA                    michelle.gleeson at uts.edu.au
>When you get to the end of your rope, tie a knot and hang on - FDR
>TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
>
>On 31 May 1997, Steven Sullivan wrote:
>
>>
>>
>> Could someone post a reliable method (or Biotechniques citation for same)
>> for rapid screening of bacterial colonies via PCR?  You know, one of those
>> methods where you touch the colony with a toothpick or pipette tip and
>> swirl it into the PCR reaction.  Thanks.
>>
>>
>>
>>
>





More information about the Methods mailing list