T7 or SP6 RNA Pol promoter sequence

[Joern Schwede]

Gordon Munro wrote:
> 
> I am looking for a promoter sequence for either SP6 or T7 RNA Pol .
> If anyone can help - it would save me a 30 mile trip to the library!
> 
> Gordon
> 
> *******************************************************
> Gordon Munro            email:  g_munro at globalnet.co.uk
> Cytocell Ltd
> Banbury
> UK
> 
> visit our website:  http://www.cytocell.co.uk
> 
> Opinions expressed are my own and not necessarily those of Cytocell Ltd.
> ************************************************************************Hi Gordon,

you can get the sequence for T7 on page 87 in the promega catalogue :

T7: 5'TAATACGACTCACTATAGGG3'

SP6: 5'GATTTAGGTGACACTATAG3'

enjoy your next ride.

Roland Herrmann