Use of positively charged nylon membranes for library screening
Michelle Gleeson
michelle at MOLECULE.BIO.UTS.EDU.AU
Thu May 29 19:22:17 EST 1997
Hi Helen,
I have used both Hybond+ and Nytran Plus charged nylon membranes for
plaque lifts, with no problems. After lifting the membranes, they are air
dried 10 min, then placed in 3 trays in succession which contain a piece
of Whatman 3MM paper soaked with 3 different solutions. Solution 1 is
0.2M NaOH/1.5M NaCl, Solution 2 is 0.4M TrisHCl pH 7.6/2xSSC and solution
3 is 2XSSC. The filters are placed on whatman plaque side up, for 1.5 -
2minutes, then air dried a few minutes before baking 2hrs in a vacuum
oven at 80degC (probably overkill, but at least I know that DNA is stuck
on! :-) For the actual hyb, I use the Church Buffers (PNAS 81 p1991-1995,
1984) I hope this helps,
AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit Ph (02)95144043
University of Technology Fax (02)95144003
Sydney, AUSTRALIA michelle.gleeson at uts.edu.au
When you get to the end of your rope, tie a knot and hang on - FDR
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
On 29 May 1997, Pierre Daram wrote:
> I am in the process of optimizing probe/hybridization conditions on
> Southerns for subsequent phage library screening and I have just
> discovered that the membrane I am using (ICN BIOTRANS+) is not
> recommended for phage lifts as it is positively charged.
>
> Has anybody used either this or other positively charged membranes in
> library screenings? If so was any change in methodology required, i.e.
> from traditional denat, neut, 2xSSC, for carrying out the lifts.
>
> One person I have spoken to suggested that there might be a problem with
> increased background due to proteins being bound by the +ve charge, as I
> am hoping to be able to reprobe the membranes 2-3x can anybody verify
> whether this is likely to be true.
>
> thanks in advance for any help/suggestions
>
> Helen Logan
> Logan at ensam.inra.fr
>
>
More information about the Methods
mailing list