How to make a non-sticky glass plate

[Michelle Gleeson]

Hi,

You can either try coating one plate with bind silane and leaving the
other uncoated, or treat the other plate with a product such as Sigmacote
or Coatasil (or even RainX)  I can't remember the exact name of the sticky
silane, but we got it from Sigma.

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit              Ph: (02) 9514 4043
University of Technology                 Fax:(02) 9514 4003
Westbourne St Gore Hill, NSW 2065        michelle.gleeson at uts.edu.au
When you get to the end of your rope, tie a knot and hang on - FDR
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT

On Thu, 2 Oct 1997, C.K. Chen wrote:

> Hi,
>    Could someone tell me how to make a sequencing gel glass plate
> non-sticky?  I use silver stain for sequencing gels and would like the gel
> stick on one of the glass plates.  I have tried Silan treatment for one of
> the plates.  However, the gel sticked on both plates.  I am confident that
> the plates were clean.
>
>    C.K Chen
>
>