How to make a non-sticky glass plate

[Jun-Zhi Wei]

> 
> michelle at MOLECULE.BIO.UTS.EDU.AU (Michelle Gleeson) wrote:
> 
> >Hi,
> >
> >You can either try coating one plate with bind silane and leaving the
> >other uncoated, or treat the other plate with a product such as Sigmacote
> >or Coatasil (or even RainX)  I can't remember the exact name of the sticky
> >silane, but we got it from Sigma.
> >
> >AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
> >Michelle Gleeson
> >Molecular Parasitology Unit              Ph: (02) 9514 4043
> >University of Technology                 Fax:(02) 9514 4003
> >Westbourne St Gore Hill, NSW 2065        michelle.gleeson at uts.edu.au
> >When you get to the end of your rope, tie a knot and hang on - FDR
> >TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
> >
> >On Thu, 2 Oct 1997, C.K. Chen wrote:
> >
> >> Hi,
> >>    Could someone tell me how to make a sequencing gel glass plate
> >> non-sticky?  I use silver stain for sequencing gels and would like the gel
> >> stick on one of the glass plates.  I have tried Silan treatment for one of
> >> the plates.  However, the gel sticked on both plates.  I am confident that
> >> the plates were clean.
> >>
> >>    C.K Chen
> >>
> >>
> >
> We use spray PAM with great success. It's cheap and easy to find. Just
> spray the plates and wipe down thouroughly.
> 
> V. Chiodo
> 
> 
> 
RAINAWAY also works well. We treat the shorter plate with RAINAWAY every
five runs.  The longer plate can be treated with strong alkali. Good
luck.

Jun-Zhi Wei
Dept. of Biol. Sci.
SFU. Canada