How to make a non-sticky glass plate
Bo Chiodo
vchiodo at eye1.eye.ufl.edu
Mon Oct 6 10:06:05 EST 1997
michelle at MOLECULE.BIO.UTS.EDU.AU (Michelle Gleeson) wrote:
>Hi,
>
>You can either try coating one plate with bind silane and leaving the
>other uncoated, or treat the other plate with a product such as Sigmacote
>or Coatasil (or even RainX) I can't remember the exact name of the sticky
>silane, but we got it from Sigma.
>
>AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
>Michelle Gleeson
>Molecular Parasitology Unit Ph: (02) 9514 4043
>University of Technology Fax:(02) 9514 4003
>Westbourne St Gore Hill, NSW 2065 michelle.gleeson at uts.edu.au
>When you get to the end of your rope, tie a knot and hang on - FDR
>TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
>
>On Thu, 2 Oct 1997, C.K. Chen wrote:
>
>> Hi,
>> Could someone tell me how to make a sequencing gel glass plate
>> non-sticky? I use silver stain for sequencing gels and would like the gel
>> stick on one of the glass plates. I have tried Silan treatment for one of
>> the plates. However, the gel sticked on both plates. I am confident that
>> the plates were clean.
>>
>> C.K Chen
>>
>>
>
We use spray PAM with great success. It's cheap and easy to find. Just
spray the plates and wipe down thouroughly.
V. Chiodo
More information about the Methods
mailing list