reverse transcripatase in Taq?

[Michelle Gleeson]

Hi Peter,

I once got some info on using either Tfl or TTh polymerase as a reverse
trancriptase.  I don't recall which one it was, but I think it had
something to do with substituting MnCl2 for MgCl2.  I got the enzymes from
Epicentre to test out, but never got around to it.

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit              Ph: (02) 9514 4043
University of Technology                 Fax:(02) 9514 4003
Westbourne St Gore Hill, NSW 2065        michelle.gleeson at uts.edu.au
When you get to the end of your rope, tie a knot and hang on - FDR
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT

On Fri, 17 Oct 1997, Peter Schuchert wrote:

> It was once reported that Taq can also reverse transcribe RNA.
> What's the actual opinion on that?
>
> I try to make rt-PCR of a weakly expressed gene and get specific bands
> even without reverse transcription (contamination can be excluded,
> the RNA has been treated with DNAseI and the genomic copy has an intron,
> so that can be excluded too).
> Any hints before I go and try RNAse treatment (reluctantly!!)
>
> cheers,
> Peter
>
>
>
> -------------------------------------------------------
> Dr. P. Schuchert
> University Hospital INSEL
> Gastroenterology Unit  MEM-B814
> CH-3010 Bern Switzerland
> Tel 0041 31 632 84 92    Fax 0041 31 632 96 65
> -------------------------------------------------------
>
>