Removal of dried acrylamide gel from UV-glass??
Michelle Gleeson
michelle at MOLECULE.BIO.UTS.EDU.AU
Tue Oct 28 00:19:59 EST 1997
Hi Joyce,
You could try alconox detergent 1percent solution. I find it removes
dried agarose from gel combs and plates, as well as dried acrylamide from
sequencing plates. You will need gloves, as it seems to cause dermatitis
in many people. Hope this helps!
AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit Ph: (02) 9514 4043
University of Technology Fax:(02) 9514 4003
Westbourne St Gore Hill, NSW 2065 michelle.gleeson at uts.edu.au
When you get to the end of your rope, tie a knot and hang on - FDR
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
On 27 Oct 1997, Joyce Faler wrote:
> I am trying to remove dried acrylamide gel from UV-glass
> beloning to a transilluminator. Prolonged soaking in warm
> soapy water has not rehydrated it enough to remove from
> the glass. I don't want to use anything stronger than
> a sponge in scrubbing the area, for fear of scratching
> the UV filter surface. The Hoeffer/Pharmacia Biotech Rep
> didn't have any other suggestions.
>
> ANY IDEAS??
>
> Thank you!
> Joyce Faler
>
>
More information about the Methods
mailing list