miniprep substitute

Michelle Gleeson michelle at MOLECULE.BIO.UTS.EDU.AU
Thu Sep 18 16:44:48 EST 1997


Hi Peter,

Just to give you plenty of choice, here is another colony screening
method, which fits in well with picking and storing colonies.  Touch the
colony with a toothpick (birch or plastic, not pine), make a short streak
on a  storage plate, and then swirl the toothpick into 100ul sdH2O.  Boil
tubes 5 minutes, then snap chill in an ice/water slurry.  Use 5ul in a
50ul PCR using either the original PCR primers or the plasmid primers -
very useful to screen multiple inserts at the same time.  By the time the
results are ready, the short streaks have usually grown enough to
inoculate a miniprep culture with.  The only catch is that the boiled
preps do not keep overnight, make them fresh before PCR.

AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit              Ph: (02) 9514 4043
University of Technology                 Fax:(02) 9514 4003
Westbourne St Gore Hill, NSW 2065        michelle.gleeson at uts.edu.au
When you get to the end of your rope, tie a knot and hang on - FDR
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT

On Thu, 18 Sep 1997, Peter Schuchert wrote:

> I heard that colonies of plasmid transformed E. coli
> can be examined for cloned inserts by boiling a little bit
> of the cells and using this for a PCR.
> Could anyone please give me more details on this protocol.
> Thanks in advance,
> Peter
>
>
> -------------------------------------------------------
> P. Schuchert
> University Hospital INSEL
> Dept. Gastroenterology,  MEM-B814
> CH-3010 Bern Switzerland
> Tel 0041 31 632 84 92    Fax 0041 31 632 96 65
> http://www.unibas.ch/dib/zoologie/research/schuch.html
> -------------------------------------------------------
>
>




More information about the Methods mailing list