Heat Shock DH5a
Michelle Gleeson
michelle at MOLECULE.BIO.UTS.EDU.AU
Tue Aug 4 17:23:46 EST 1998
Hi,
Well, in the lab I come from, people have been known to take short cuts
and skip the heat shock altogether (using DH5a). It works OK, maybe not
quite as many clones. I'm sure there is a reference around about it, but
I don't have it on hand. I was also under the impression that heat shock
makes transient pores in the membrane, though not in the same was as
electroporating.
AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit Ph: (02) 9514 4043
University of Technology Fax:(02) 9514 4003
Westbourne St Gore Hill, NSW 2065 michelle.gleeson at uts.edu.au
AUSTRALIA
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
On Tue, 4 Aug 1998, Keith Rand wrote:
> In article <19980803113120.468f1e43.in at genvec.com>, "Lou Cantolupo"
> <lou_cantolupo at genvec.com> wrote:
>
> > Settle an argument for me. Does the heat shock step in a CaCl2
> > transformation of DH5a (or whatever bug of choice) activate heat shock
> proteins for
> > recovery or make the cells more porous?
>
>
> Well, it seems to be generally believed that the heat shock is involved in
> some way with the entry of the DNA into the cells. So 'making the cells
> more porous' would be the correct answer. It would be interesting to hear
> the case for the induction of heat shock proteins, but I don't think
> anyone has reported an increase in viability due to the heat shock.
>
> --
> Keith Rand, Sydney Australia
>
>
More information about the Methods
mailing list