benzyldimethylalkylammonium choride??

Michelle Gleeson michelle at MOLECULE.BIO.UTS.EDU.AU
Tue Aug 11 00:36:56 EST 1998


Hi all,

I am in search of the chemical benzyldimethylalkylammonium chloride.  It
is for use as an alternative to cytochrome C in electron microscopy of
DNA.  I have searched Sigma, Fluka, Aldrich, and Lancaster, and I have
found similar compounds (I think) - but with the alkyl substituted with
hexadecyl, tetradecyl, stearyl or (2-hydroxyethyl)  The reference the
original name comes from is oldish (1975), and I wondered whether there
may have been a change in nomenclature.  If there are any chemists out
there who can help me with a source, or tell me if any of these
substitions are functionally identical I would appreciate it!

Michelle
AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit              Ph: (02) 9514 4043
University of Technology                 Fax:(02) 9514 4003
Westbourne St Gore Hill, NSW 2065        michelle.gleeson at uts.edu.au
AUSTRALIA
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT




More information about the Methods mailing list