Which should be CIPed, 7K one or 3K one?

Beth Wapelhorst weazel at animal.blarg.net
Tue Aug 25 20:42:29 EST 1998


phosphatase the one that's got the drug resistant gene in it.

shengyang at USA.NET (Yang Sheng) writes:

>Hi, all!

>	I am to link a 3K fragment with a 7k one. They were cut out by ScaI from two plasmids 
>derived from pBluscript SK(+). I considered that one should treated with CIP to prevent it from 
>self-circlized. So, which should be CIPed?

>Thank you for your advice.
>ATGCGTTTTAAACCGTTTGTAACTGTTTTCTTCGACTGAAACTGGACTGGATCATGAAGCTGTAG
> _____  ________ _______ _______ _  Yang Sheng
> __  / / /_  __ `/_  __ \__  __ `/  Shanghai Inst. of Biochem.
> _  /_/ / / /_/ /_  / / /_  /_/ /   Academia Sinica,320 Yueyang Rd.
> _\__, /  \__,_/ /_/ /_/ _\__, /    Shanghai 200031,P.R.China
> /____/                  /____/     Tel: 86-21-6437-4430ext.243
>                                    http://www.sibc.ac.cn/
>ATGGCAAATCCGTATGCGTTTTAAACCGTTTGTAACTGTTTTCTTCGACTGAAACTGGACTGGATC

-- 
sugar beth wapelhorst              "I don't think I'm alone when I say I'd
weazel at blarg.net                    like to see more and more planets fall
www.blarg.net/~weazel               under the ruthless domination of our
                                    solar system." - Jack Handey



More information about the Methods mailing list