Which should be CIPed, 7K one or 3K one?

Patrick F.H. Lai pfhlai at LOOKSMART.COM
Wed Aug 26 00:25:15 EST 1998


---- Begin Original Message ----
>Hi, all!
>
>	I am to link a 3K fragment with a 7k one. They were cut out by >ScaI from two plasmids 
>derived from pBluscript SK(+). I considered that one should treated >with CIP to prevent it from 
>self-circlized. So, which should be CIPed?
>
>Thank you for your advice.
>ATGCGTTTTAAACCGTTTGTAACTGTTTTCTTCGACTGAAACTGGACTGGATCATGAAGCTGTAG
> _____  ________ _______ _______ _  Yang Sheng
> __  / / /_  __ `/_  __ \__  __ `/  Shanghai Inst. of Biochem.
> _  /_/ / / /_/ /_  / / /_  /_/ /   Academia Sinica,320 Yueyang Rd.
> _\__, /  \__,_/ /_/ /_/ _\__, /    Shanghai 200031,P.R.China
> /____/                  /____/     Tel: 86-21-6437-4430ext.243
>                                    http://www.sibc.ac.cn/
>ATGGCAAATCCGTATGCGTTTTAAACCGTTTGTAACTGTTTTCTTCGACTGAAACTGGACTGGATC
>
---- End Original Message ----

Dear Dr. Yang Sheng,

I am not sure if I fully understand the situation.
Sca I cuts the amp-resistance gene in pBSII(SK+)
I assume neither the 3k- nor the 7k-fragment contains sequences from
the vector(s).  And, the 10k-fragment resulted will be inserted into
a vector later on.  (Otherwise, the following is useless.)
I also assume you have both fragments already purified.

Now, I have two questions:
1. Can other restriction enzymes be used to release the fragments ?
These blunt ends drive me nuts sometimes.
2. Do you need to preserve the Sca I site where this ligation takes
place ?

If the answer to question 2 is 'NO', then i would suggest trying the 
following procedures that I HAVE NEVER THOUGHT ABOUT aND NEVER TRIED
BEFORE:

a.  Add a 3'-overhanging T to both ends of one fragment with Taq polymerase and dTTP at 72'C.
b.  Add 3'-overhanging A's to the other fragment with Taq and dATP...
c.  TA-ligation.

This way, there's no need to CIP to prevent SELF-circularization, 
and there will be good chance that the right ligation will take place.
(Not perfect, though.   ~25% right, if the DNA stays linear.)

And, the 10k-fragment will probably circularize !
(CIP'ing either fragment will have the same problem, though.)


In order to obtain the properly linked linear 10k-fragment,
long PCR (using hi fi enzymes, of course) may be done.
The inappropriately ligated products will not be amplified as the
orientation will be wrong.

Sca I sites may be included in the primers, if necessary.
Cutting with Sca I again will give you the same terminals, but the 
ligation site won't be cut as this Sca I site is now destroyed.

Now, the 10k-fragment can be ligated into your vector of choice as 
usual......


Well, this is too darned complicated and expensive, eh ?
Yeah, I know.  :-)
So, back to question 1 :  can Sca I be replaced ?

Come to think of it, how about not worrying circularization and let
the 2 fragmeents ligate ?  The proper linking is bound to happen.
Gel extract whatever is 10 kb, and PCR this DNA as described above.
I hope you don't need the halved Sca I sites at ends of the 10-kb fragments.

good luck.






Hope this is useful info.   :-)


Patrick F.H. Lai  < PFHLai at looksmart.com >
Graduate Student
University of Toronto
Toronto, Ontario, Canada





       
LookSmart … or keep looking.
http://www.looksmart.com



More information about the Methods mailing list