Which should be CIPed, 7K one or 3K one?

Nemo Peeters peeters at versailles.inra.fr
Wed Aug 26 07:03:05 EST 1998


Hi, 
To my mind you should CIP the one bearing the ori of replication and the
antibiotic selection gene. If these two sequences are on each of your
fragments, and if your fragments are clean, you shouldn't CIP at all,
because the only plasmid that will be selected, will be the fusion of your
two fragments.
Regards
Nemo




In article <199808250350.LAA11698 at mail.shcnc.ac.cn>, shengyang at usa.net wrote:

> Hi, all!
> 
>         I am to link a 3K fragment with a 7k one. They were cut out by
ScaI from two plasmids 
> derived from pBluscript SK(+). I considered that one should treated with
CIP to prevent it from 
> self-circlized. So, which should be CIPed?
> 
> Thank you for your advice.
> ATGCGTTTTAAACCGTTTGTAACTGTTTTCTTCGACTGAAACTGGACTGGATCATGAAGCTGTAG
>  _____  ________ _______ _______ _  Yang Sheng
>  __  / / /_  __ `/_  __ \__  __ `/  Shanghai Inst. of Biochem.
>  _  /_/ / / /_/ /_  / / /_  /_/ /   Academia Sinica,320 Yueyang Rd.
>  _\__, /  \__,_/ /_/ /_/ _\__, /    Shanghai 200031,P.R.China
>  /____/                  /____/     Tel: 86-21-6437-4430ext.243
>                                     http://www.sibc.ac.cn/
> ATGGCAAATCCGTATGCGTTTTAAACCGTTTGTAACTGTTTTCTTCGACTGAAACTGGACTGGATC



More information about the Methods mailing list