Which should be CIPed, 7K one or 3K one?

Yang Sheng shengyang at USA.NET
Wed Aug 26 23:05:53 EST 1998


Hi, all!

Many thanks for your kind help!

My question might be ambigious in some degree. How did I put myself into a blunt-end clone? It is 
because that I was going to site-directed mutagenisis an enzyme by PCR. The gene of the enzyme is 
on a plasmid of Bacillus subtilis, I found that it was hard to do cloning in Bacillus for its 
effiency of transformation is rather low (<10*5). So I cloned the whole plasmid into pUC18 to 
construct a shuttle plasmid and meanwhile the PCRed fragment which contains converted bases was 
TA cloned into pBluescript SK(+). While, the original design was to replace the fragment by ScaI 
and SalI. The ScaI is in the middle of the gene and SalI is behind the TAG. So, I should cut the 
plasmids by ScaI to meet the two parts of gene. You know, the bla(ampR) contain the site of ScaI. 
I had thought that ScaI and ligase could do all. I tried and tried, but I could not get the 
recombinant plasmid :-(. 

CIPing one of the fragments? Increasing transformation effiency (My competent cell is 10*7/ug 
pBR322)? 

I think that the CIP question could be simplized into:

Which is easier to be self-circularized, 3k or 7k?

Dr. Hiranya Sankar Roychowdhury said:
>The scenario you describe does not need removal of PO4.  Since the ori and
>the ampR have been separated, there is little chance of recovering anything
>else. Concatenation may be expected, but the desired plasmid will
>predominate. We routinely ligate and transform with plasmids >10kb, so it is
>not quite as unthinkable as people tend to believe. Hence, you should be
>able to obtain a large enough # of transformants to screen for the right
>plasmids. 

I wish so.

Best regards!
ATGCGTTTTAAACCGTTTGTAACTGTTTTCTTCGACTGAAACTGGACTGGATCATGAAGCTGTAG
 _____  ________ _______ _______ _  Yang Sheng
 __  / / /_  __ `/_  __ \__  __ `/  Shanghai Inst. of Biochem.
 _  /_/ / / /_/ /_  / / /_  /_/ /   Academia Sinica,320 Yueyang Rd.
 _\__, /  \__,_/ /_/ /_/ _\__, /    Shanghai 200031,P.R.China
 /____/                  /____/     Tel: 86-21-6437-4430ext.243
                                    http://www.sibc.ac.cn/
ATGGCAAATCCGTATGCGTTTTAAACCGTTTGTAACTGTTTTCTTCGACTGAAACTGGACTGGATC




More information about the Methods mailing list