XhoI problems/Footprinting
Yang Sheng
shengyang at kali.com.cn
Wed Jun 17 06:52:51 EST 1998
At 98-6-16 13:35:00, you wrote:
>Dear All,
>
>I am having the most ridiculous problems in preparing large amounts of
>small DNA fragments for DNA footprinting. I am trying to bulk up a 340
>bp fragment from one of our well used plasmids. The method is simple,
>cut SmaI, isolate by agarose gel purification a 2000bp frag (by qiagen
>qiaexII), cut XhoI, and agarose gel purify again, pulling out a 340 bp
>band. Sounds straight forward. I cannot get complete digestion with XhoI
>(~50%), which is dramatically reducing my yield. I have used different
>plasmid preps, different batches of XhoI (all well within their shelf
>life), with very extended incubation times, all to no avail. All the
>digest conditions are perfect for the enzyme, and sufficient enzyme is
>being used. To top it all my qiagen qiaex is only working to about 60%
>recovery.
>
>If you have any ideas about my XhoI problems or suggestions for
>purifying large amounts of small fragments of DNA from plasmids for
>footprinting, I would be interested in hearing them.
Hi, you are not alone. I have encounted similar problem like yours. I digested my
plasmid partially with ScaI, isolated a 3.4kb fragment by agarose gel. Then digested by XhoI,
but I can not get complete digestion too (<50%). I tried and tried, all to no avail.
Finally I changed my clone scheme ...
Wish you good luck!
ATGAAGCTGACTTTGACCTGACCTAG
Yang Sheng
Shanghai Inst. of Biochem.
http://www.sibc.ac.cn/
Phone:86-21-64374430-243
TACTTCGACTGAAACTGGACTGGATC
More information about the Methods
mailing list