problems with reverse primer

Mohammad H Ghahremani mghahrem at uottawa.ca
Wed Mar 4 11:54:49 EST 1998


Hi Brett,

Here are the problems with the primers beside the difference in tm:

Hairpin

      GCCGACAC--\     G=-2.1 kc/m
      | ||||     C
TTCGAATCAGCTGGA-/


Primer self Dimer

GCCGACACCAGGTCGACTAAGCTT      G=-10.2 kc/m    
                  ||||||
                  TTCGAATCAGCTGGACCACAGCCG
              
Primer pair dimer

AAGCTTATGGCCATGCTCCTGGGG      G=-11.2 kc/m
|||||||            | ||
TTCGAATCAGCTGGACCACAGCCG



Good luck,

Mohammad
      _ _
_ooO_(o o)_Ooo

Neuroscience Res. Inst.



More information about the Methods mailing list