DNA quantitation : what a pain

June Eva Paciga jpaciga at com1.med.usf.edu
Mon Mar 9 15:21:05 EST 1998


Try making your nucleic acid dilutions in TE.  I find that I get
variable readings if I dilute
nucleic acids in water.

--
June Eva Paciga
gccaaggcttgattgatcaccacattagagtgagaagtggca
Univ South Florida-Pathology
Tampa FL
jpaciga at com1.med.usf.edu





More information about the Methods mailing list