3-D structure of DNA
Paralee PK
paraleepk at aol.com
Tue Sep 8 23:07:17 EST 1998
I'm taking a molecular biology class. The professor gave us a problem set. He
said we could ask anyone for help. I'm asking you! Here's the problem:
You want to determine the 3-D structure of a 25 base pair oligonucleotide
duplex. The sequence is:
5'TTTTTAAAAATTTTTGGGGGGGGGG3'
3'AAAAATTTTTAAAAACCCCCCCCCC5'
A. Describe the kinds of secondary and tertiary DNA structues that youmight
expect to find in the DNA.
B. Propose a multi-approach experimental strategy for testing your hypotheses.
Describe the kinds of information each approach would provide, andhow the
approach could be used to confirm or discount your hypotheses. What could be
the alternative outcomes and conclusions?
I was considering making a flow chart of the approaches and possible outcomes.
We've been talking about the various microscopies, NMR and crystallography.
I'm assuming we would use those methodologies.
Thanks.
More information about the Methods
mailing list