cloning of small DNA fragments (66 bp)
Frederik Boernke
boernke at nospam.ipk-gatersleben.de
Mon Aug 2 19:32:19 EST 1999
Hi all,
I'd like to construct an expression cassette where a gene of
interest is translationally fused to a signal peptide in order
to target proteins into the secretory pathway. For that purpose
I'd like to employ the A. thaliana basic chitinase signal sequence
which consists of 66 nucleotides. What would be the best way to
clone such a small fragment? PCR or doing some oligo annealing
stuff? Any will be appreciated.
TIA
Ricky
ATGCATCGTGATCAATCGTATCCCGTGGAAGTACGTACGTAGCACGG
Frederik Boernke
Research Group of Molecular Plant Physiology
Institute for Plant Genetics and Crop Plant Research (IPK)
Corrensstr. 3
06466 Gatersleben
Tel. 039482 -5 321
Fax. 039482 -5 515
http://www.ipk-gatersleben.de
More information about the Methods
mailing list