cloning of small DNA fragments (66 bp)

[Eric Chace Olivares]

Hey Frederik...

If you've got convenient restriction sites, order oligos that contain the
desired sequence, along with the half-restriction sites that will
facilitate your cloning.  Oligo annealing for cloning purposes is very
easy, I just mix the two in equimolar ratios (in TE) heat to 65C, and
allow to cool in styrofoam, or better yet in a beaker of 65C water set on
the bench.  The mixture can then be used in a standard ligation.

Of course, if you don't have convenient sites, PCR will be your method of
choice, It is certainly possible to employ a primer containing an arm
of non-homology.  While I've done this with "arms" of ~35bp with no
special care taken in the PCR, your sequence appears longer and might
require further optimiziation.

Good luck!

-=Eric

Frederik Boernke (boernke at nospam.ipk-gatersleben.de) wrote:
: Hi all,
: 
: I'd like to construct an expression cassette where a gene of 
: interest is translationally fused to a signal peptide in order
: to target proteins into the secretory pathway. For that purpose
: I'd like to employ the A. thaliana basic chitinase signal sequence
: which consists of 66 nucleotides. What would be the best way to
: clone such a small fragment? PCR or doing some oligo annealing
: stuff? Any will be appreciated.
: 
: TIA
: Ricky 
: 
: ATGCATCGTGATCAATCGTATCCCGTGGAAGTACGTACGTAGCACGG
: 
: Frederik Boernke
: Research Group of  Molecular Plant Physiology
: Institute for Plant Genetics and Crop Plant Research (IPK)
: Corrensstr. 3
: 06466 Gatersleben
: Tel.  039482 -5 321
: Fax. 039482 -5 515
: http://www.ipk-gatersleben.de

-- 
Eric C. Olivares
Department of Genetics
Stanford University School of Medicine
olivares at stanford.edu
http://www.stanford.edu/~olivares/