cloning of small DNA fragments (66 bp)
Jim Kami
jakami at ucdavis.edu
Wed Aug 4 20:02:52 EST 1999
I don't know what your budget is like, but you might want to just
have the fragment synthesized with the restriction ends of your choice.
By way of example; a 66 bp ds DNA fragment with a 4 base overhanging
ends @ $1.00/base and $20 setup fee per strand would be about $180US.
This is probably less than you would spend in time and materials to
clone and isolate the fragment and you don't have to try to find native
restriction sites.
Jim Kami
Blue Rose Biotech
Davis, California 95616
Frederik Boernke wrote:
> Hi all,
>
> I'd like to construct an expression cassette where a gene of
> interest is translationally fused to a signal peptide in order
> to target proteins into the secretory pathway. For that purpose
> I'd like to employ the A. thaliana basic chitinase signal sequence
> which consists of 66 nucleotides. What would be the best way to
> clone such a small fragment? PCR or doing some oligo annealing
> stuff? Any will be appreciated.
>
> TIA
> Ricky
>
> ATGCATCGTGATCAATCGTATCCCGTGGAAGTACGTACGTAGCACGG
>
> Frederik Boernke
> Research Group of Molecular Plant Physiology
> Institute for Plant Genetics and Crop Plant Research (IPK)
> Corrensstr. 3
> 06466 Gatersleben
> Tel. 039482 -5 321
> Fax. 039482 -5 515
> http://www.ipk-gatersleben.de
More information about the Methods
mailing list