primer design for stratagene's quick change mutagenesis

Frederik Boernke boernke at nospam.ipk-gatersleben.de
Mon Aug 23 17:05:25 EST 1999


Dear friends,

I'd like to introduce a single nucleotide exchange into my gene of
interest using stratagene's quick change kit. The manual says both
mutagenic primers must contain the desired mutation and anneal to the
same sequence on opposite strands of the plasmid. Does this mean the
primers must be complementary to each other and if so aren't primer
dimers which occur during the reaction a problem?
Another thing is that my favorite gene is something like 3kb in length
and the plasmid is another 3.5 kb, so do I have to expect some unwanted
mutation due to the length of the template?
Please enlighten me.

TIA
Ricky

ATGCATCGTGATCAATCGTATCCCGTGGAAGTACGTACGTAGCACGG

Frederik Boernke
Research Group of  Molecular Plant Physiology
Institute for Plant Genetics and Crop Plant Research (IPK)
Corrensstr. 3
06466 Gatersleben
Tel.  039482 -5 321
Fax. 039482 -5 515
http://www.ipk-gatersleben.de



More information about the Methods mailing list